ID: 969222774

View in Genome Browser
Species Human (GRCh38)
Location 4:5772316-5772338
Sequence CTCTTTGCAGGGAGGTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969222774_969222783 20 Left 969222774 4:5772316-5772338 CCATCTTACCTCCCTGCAAAGAG 0: 1
1: 0
2: 2
3: 24
4: 236
Right 969222783 4:5772359-5772381 GTTCAAGAAGCAAACAGACCAGG 0: 1
1: 0
2: 1
3: 24
4: 242
969222774_969222785 27 Left 969222774 4:5772316-5772338 CCATCTTACCTCCCTGCAAAGAG 0: 1
1: 0
2: 2
3: 24
4: 236
Right 969222785 4:5772366-5772388 AAGCAAACAGACCAGGTTATGGG No data
969222774_969222784 26 Left 969222774 4:5772316-5772338 CCATCTTACCTCCCTGCAAAGAG 0: 1
1: 0
2: 2
3: 24
4: 236
Right 969222784 4:5772365-5772387 GAAGCAAACAGACCAGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969222774 Original CRISPR CTCTTTGCAGGGAGGTAAGA TGG (reversed) Intronic
900099540 1:955705-955727 CCCTTTTCAGGAAGGAAAGAAGG + Intronic
901032874 1:6318483-6318505 CTTTGTGCACGGAGGTAAGAAGG - Exonic
901590486 1:10337384-10337406 CACTTTGCTGGATGGTAAGATGG + Exonic
902545437 1:17186696-17186718 CTCCTTGCAGAGAGGGCAGAAGG + Intergenic
904156689 1:28489533-28489555 CTGTTTTCAGGGAGCTAAGGAGG + Intronic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
905150798 1:35925837-35925859 TTCTATGCATGGGGGTAAGAAGG + Exonic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906054490 1:42904585-42904607 CTCCCTCCAGGGAGGTAGGAGGG - Intergenic
906188142 1:43877382-43877404 TTCTCTGCAGGGAAGTGAGAAGG - Intronic
907861070 1:58353946-58353968 TTCTTCGCAGGGAGGTAGAATGG - Intronic
908669940 1:66534612-66534634 GTGTTTGCAGGGAGCTGAGATGG + Intronic
909066750 1:70944382-70944404 CTCTTTTCATGGTGGTAACAGGG - Intronic
909568751 1:77084460-77084482 CTCTCTGCAAGGAGGTATGCTGG + Intergenic
910069365 1:83193184-83193206 CTCTTAGAAGGGAGGCAACATGG - Intergenic
912724373 1:112045536-112045558 CTCTTGGCCGGTAGGTAAAATGG - Intergenic
913259779 1:116987742-116987764 CTCTGTCCAGGGCAGTAAGAAGG + Exonic
914449616 1:147779184-147779206 TTCTTTGCACGGTGGCAAGAAGG - Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915659670 1:157392063-157392085 TTCTTTACAGGGTGGTAGGATGG + Intergenic
916060346 1:161093953-161093975 CTCCTTGCAGGAAAGTCAGATGG + Intergenic
916790243 1:168118979-168119001 CTGTTGGCAGGGACGTAAAATGG + Intronic
917926692 1:179795051-179795073 CTCTTGGCAAGGTGGTAAGAAGG + Intronic
919919529 1:202160002-202160024 CTCTGTCCAGGGAGGTAGGCTGG + Intronic
920079931 1:203365592-203365614 AACGTTGCAGGGAGGTATGATGG + Intergenic
920126854 1:203700356-203700378 GTGTTTGCAGGGAGGTAAATGGG - Intronic
1065284051 10:24170226-24170248 CTTTTTGCCGGGTGGTAAGTTGG + Intronic
1066210792 10:33235988-33236010 CTCTTTGCAGGAAGGGGAGGAGG - Intronic
1066254191 10:33662785-33662807 CTGTTTGAAGGTAGGTAGGAGGG - Intergenic
1067741094 10:48896732-48896754 CACTTGGCAGGGAGGTTTGAGGG - Intronic
1067760019 10:49038001-49038023 CTCTTTGTAGGAATGTAAAATGG + Intronic
1068506231 10:57902973-57902995 TTGTTGGCAGGAAGGTAAGATGG + Intergenic
1068588041 10:58822406-58822428 ATCTTTTGGGGGAGGTAAGATGG + Intronic
1068701230 10:60022364-60022386 CTCATTGCAGACAGGTAACAAGG + Intergenic
1069074488 10:64024072-64024094 CTCTCACCAGGGAGGCAAGACGG + Intergenic
1069787596 10:70998567-70998589 CTCTTTGCACAGAGGTATTATGG + Intergenic
1073031402 10:100529227-100529249 CTCTGTGGAGGGAGGTGGGAGGG - Intronic
1075458812 10:122602243-122602265 TTCTTAGCAGGGAGCTAACAAGG - Intronic
1075459443 10:122606302-122606324 TTCTTAGCAGGGAGCTAACAAGG - Intronic
1075460075 10:122610361-122610383 TTCTTAGCAGGGAGCTAACAAGG - Intronic
1075460707 10:122614420-122614442 TTCTTAGCAGGGAGCTAACAAGG - Intronic
1075585641 10:123656112-123656134 CTCATGGCAGAGAGGTTAGAGGG - Intergenic
1076513781 10:131031663-131031685 CTCCTTGCAGGGAGGGAACTCGG + Intergenic
1077425475 11:2473973-2473995 CCCTTGGGAGGGAGGTAAGCGGG + Intronic
1077662679 11:4083508-4083530 CTCTTTGCGGGGATGAAGGAAGG + Intronic
1078052131 11:7974957-7974979 AGCTTTGCAGGGAGGGAAGAAGG + Intronic
1080465825 11:32496071-32496093 CTCTGTGCAGGGAGTTTAGTGGG - Intergenic
1081430408 11:42970480-42970502 CTCTTGAAAGGGAGGAAAGAAGG - Intergenic
1084052865 11:66612266-66612288 CTCTTGGCAGGTATGTATGAAGG - Intergenic
1084800784 11:71542507-71542529 CTCTGTGCCGGGAGCCAAGAAGG + Intronic
1088222982 11:107589814-107589836 TTCTTTTCAGGGAGATATGAAGG - Intergenic
1088855067 11:113742203-113742225 CTCCTTGCATTGAGGTAAGAAGG - Intronic
1090805809 11:130201409-130201431 CCCTTTGCAGGGAGGAGAGATGG + Intronic
1091384660 12:85449-85471 GACTTTGCAGGGAGCCAAGAGGG - Intronic
1091621316 12:2091513-2091535 CTCTTTGCAGGTAGAGGAGAGGG - Intronic
1092069631 12:5622231-5622253 CTCTTTGCAGGGAACTTGGAGGG - Intronic
1094593584 12:31843871-31843893 CTCTTCACAGGGAGGCAGGAAGG - Intergenic
1095982824 12:47982608-47982630 CCCTGGGGAGGGAGGTAAGAGGG + Exonic
1097321766 12:58233540-58233562 CTTTCTGCAGGGAAGTATGAAGG + Intergenic
1097959159 12:65515511-65515533 CAATTTTCAGGGAAGTAAGAAGG - Intergenic
1097983690 12:65760359-65760381 CTCTTGGCAGGGTGATTAGATGG - Intergenic
1099823326 12:87743157-87743179 CAATTTCCAGGGAGCTAAGAAGG - Intergenic
1102188528 12:110968233-110968255 CTCATTCCAGGGAGGAAAAAGGG + Intergenic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1102727992 12:115082380-115082402 CTCTTTGAAGGAAGCAAAGATGG - Intergenic
1102977710 12:117218489-117218511 CACGTTGGAGGGAGGAAAGAGGG - Intronic
1105629554 13:22148749-22148771 ATCTTAGCAGTGTGGTAAGATGG - Intergenic
1107436649 13:40386259-40386281 TTCTTTGCAGGCTGGTCAGAGGG - Intergenic
1107448964 13:40491630-40491652 ATGTTTGCAGGGAGGCAAGAAGG + Intergenic
1108739695 13:53322977-53322999 CTCTTTTCTGGGAGAGAAGAGGG + Intergenic
1109672131 13:65623051-65623073 CTATTGGCAGGAAGGTAAAATGG - Intergenic
1110775623 13:79405662-79405684 CTCTTTGCAGGGATGGCAGTGGG - Intronic
1113783085 13:112987664-112987686 GTCTTTGCACGGTGGTGAGAGGG + Intronic
1113919189 13:113897250-113897272 TGCTTTGCAGAGAGGTGAGAAGG + Intergenic
1113954541 13:114090234-114090256 CGCTTTGCAGGCAGGTGTGAAGG - Intronic
1114642519 14:24232943-24232965 CTCTTTGCAGGGGTAGAAGAAGG + Exonic
1116171680 14:41410286-41410308 CTCTTTCTATGGAGGTTAGAAGG - Intergenic
1116310208 14:43315750-43315772 CCCTCTGTAGGGAGGTAAGCAGG + Intergenic
1116782278 14:49250078-49250100 TTTTTTGCGGGGAGGCAAGATGG + Intergenic
1119314977 14:73686044-73686066 CGGTTGGCAGGGAGGTAAAATGG - Intronic
1120077319 14:80173296-80173318 CTCTTGGCAGGGAAGGAAGCAGG + Intergenic
1122180026 14:99948107-99948129 CTCTTTGAAGAGAAGAAAGAGGG + Intergenic
1122357565 14:101132712-101132734 CTGTCTCCAGGGAGGTGAGAGGG - Intergenic
1125726142 15:41869138-41869160 CTCATTGCATGGAGGAAGGAAGG + Intronic
1126997540 15:54462433-54462455 CTGTTTGCAGGGAGGTGTGGAGG + Intronic
1127930238 15:63591506-63591528 TTGTTTGCGGGGAGGTAAGATGG + Intronic
1127957136 15:63863294-63863316 CTCTTTGCAGGGTTTTAAGCAGG + Intergenic
1131079340 15:89521750-89521772 CTAATTGCAGGGAGGAAGGAGGG - Intergenic
1133294848 16:4746670-4746692 GTCCCTGCAGGGAGGGAAGAGGG + Intronic
1137947374 16:52746996-52747018 GTCTTTGGAGGGTGGTAAGCAGG - Intergenic
1138077075 16:54053154-54053176 ATCTCTGCAGAGAGGAAAGATGG - Intronic
1138412327 16:56850447-56850469 TTCTTTGCAGGGAGTGGAGAAGG - Intergenic
1138998911 16:62484886-62484908 CCCTTTCCAGGGAGGGAAGGGGG - Intergenic
1139347836 16:66315866-66315888 CTTTTGCCATGGAGGTAAGAGGG + Intergenic
1139521741 16:67486704-67486726 CTCTGTGCAGGGAGGAGAAAGGG + Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140310023 16:73840198-73840220 AACGTAGCAGGGAGGTAAGATGG + Intergenic
1142730186 17:1849120-1849142 CTGTTGGCAGGGAGGTAAACTGG - Intronic
1143490455 17:7282600-7282622 CTCCCTGCACGGAGGTTAGAGGG + Intronic
1147555374 17:41475701-41475723 CTCTTTGCAGGGGGCTAGAAAGG + Intergenic
1148468289 17:47877892-47877914 GTCTTAGGAGGGAGGGAAGAGGG - Intergenic
1150432433 17:65129169-65129191 CTCTTTGTAAGGAGCTGAGAGGG - Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1153812440 18:8763856-8763878 ATCATTTCAGGGAGGTAAGTGGG - Intronic
1155053721 18:22168548-22168570 CTGTTTGGAGGGAGCGAAGAGGG + Intergenic
1156022752 18:32618532-32618554 CTCTGTTCAGGGTAGTAAGAGGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157931065 18:51824004-51824026 CTCTTTGCTGATGGGTAAGAAGG + Intergenic
1159957642 18:74530993-74531015 CTCTTTCCAGGGAAGTAAATGGG + Intergenic
1161978470 19:7618854-7618876 GACTTTGCAGGGAGGTGACAGGG - Intergenic
1162263012 19:9547800-9547822 CTGCTTGCAGGGAGGTGAGGAGG + Intergenic
1165283769 19:34820148-34820170 CACTTTGCAGAGTGGGAAGAAGG + Intergenic
1165797134 19:38525930-38525952 GTCTTGGCAGGGAGGGAAGGAGG - Intronic
1167449905 19:49560927-49560949 CTCTTTGTTTGGAGGTAAGAGGG + Intronic
1202703425 1_KI270713v1_random:4429-4451 GGCTTGGCCGGGAGGTAAGAGGG + Intergenic
925565118 2:5244187-5244209 GTTTTTTCTGGGAGGTAAGATGG - Intergenic
925619413 2:5776459-5776481 CTCTTTGCAGGTATGTGTGATGG + Intergenic
927433679 2:23048590-23048612 CACTTTGCAGGGTAGTTAGAAGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928535122 2:32232666-32232688 ATGTTTGCAGGGATGGAAGATGG + Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
930319681 2:49838557-49838579 ATCTTGGCTGGGAGGTAAAATGG - Intergenic
933038784 2:77433923-77433945 CTCTTTGCATGAAGCTCAGATGG - Intronic
935792173 2:106602618-106602640 TTCTTTGCAGGGATGTAACAGGG + Intergenic
937609317 2:123840865-123840887 CTCTGTGCAGGAAGGTGAGGTGG - Intergenic
940146333 2:150548459-150548481 TTCTTGGCAGGGAAGTAAGTTGG + Intergenic
940742419 2:157524023-157524045 CTCTTTTCAGGGATGTAGCAAGG + Intergenic
942723251 2:178977452-178977474 TTCTTTTCAGGGAAGAAAGATGG + Intronic
944194875 2:197041780-197041802 ATTTTTGAAGAGAGGTAAGATGG - Intronic
944961167 2:204875741-204875763 CTCTTTGTAGGTATGTAAAAAGG + Intronic
947204310 2:227646187-227646209 CTCTTTTCAGGCAGGCAAGGTGG - Intergenic
947298910 2:228666180-228666202 CTCTCTGCAGGACAGTAAGAAGG + Intergenic
1169711866 20:8573632-8573654 CTTTTTACAGAGAGGTCAGAAGG - Intronic
1172421770 20:34824889-34824911 TTCTTTGCTGGGAGGGAAGGAGG - Intronic
1173760218 20:45553317-45553339 CTCTTTGAAGGGTGGTGGGATGG - Intronic
1175674609 20:60935987-60936009 GTCTTTGCAGGGGAGTAAGAAGG - Intergenic
1178854502 21:36239296-36239318 GACTTTGCAGGGAGGTCAGATGG + Intronic
1181866873 22:25865194-25865216 CACTTTGCAGGTGGGGAAGAGGG + Intronic
1182517266 22:30865934-30865956 GTCTTTGCAGGAAGGACAGAGGG + Intronic
1182665963 22:31960113-31960135 CTCTTTGAAAGGACCTAAGAGGG + Intergenic
1183665738 22:39244774-39244796 CTCTTTGCAGCGAGGCTGGAGGG + Intergenic
1183684503 22:39353798-39353820 TTTTTTGCAGGGGGCTAAGATGG + Intronic
1184812751 22:46847781-46847803 CTCATTCCAGGGAGGGAAAATGG + Intronic
1185031582 22:48446289-48446311 CACTTGGCAGGGAGGAGAGAAGG - Intergenic
1185089342 22:48757124-48757146 CTCTTTGGAGAGAGGCAAGGAGG + Intronic
949154064 3:808157-808179 CTCTTTGCTAGGATGTAACAAGG - Intergenic
949721385 3:6994296-6994318 CCCTATGCAGGGAGGTGACATGG + Intronic
951551919 3:23882917-23882939 CTGTTTGCAGGGAGGTGTGGAGG - Intronic
951558785 3:23945774-23945796 GGCTTTGCAGGGAGACAAGAGGG - Intronic
952815865 3:37447236-37447258 CTCTCTGCAGTGAGGCAGGAGGG + Intergenic
954230598 3:49213821-49213843 CTGCTTGCAGGGAGGTGTGATGG - Intronic
954278910 3:49561502-49561524 GTGTTTGCAGGCAGGTAACAAGG + Intronic
958136883 3:89505250-89505272 CTGTTTGAATGAAGGTAAGATGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959723511 3:109518303-109518325 CTCATTGCAGGAAGGAAGGAGGG - Intergenic
961200747 3:125043506-125043528 CTTTCTGCAGGGAGGAAAGGGGG + Intronic
963945252 3:151138858-151138880 CTCTTTGGAAGGAAGTAATATGG + Intronic
964923313 3:161925239-161925261 CTCTTGACAGGGTGGCAAGAGGG - Intergenic
966738225 3:183207322-183207344 CTCTTTGCCTGGAAGAAAGAGGG + Intronic
968399937 4:285314-285336 GTGTGTGCAGGGAGATAAGATGG + Intronic
969222774 4:5772316-5772338 CTCTTTGCAGGGAGGTAAGATGG - Intronic
971328588 4:25664183-25664205 CTCTCTGCAGGGGGGTGGGATGG - Exonic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
972145990 4:36026352-36026374 CTATTGGCAGGGATGTCAGACGG + Intronic
972360982 4:38325291-38325313 CTGTTTGCAGGGAGGTGTGGAGG - Intergenic
974742368 4:66022815-66022837 CTCTTTGCAGGGTGGTAGGAAGG + Intergenic
977178434 4:93842767-93842789 CTGTTAGAAGGGAGGTAACAGGG + Intergenic
978564854 4:110070911-110070933 CTCTTTGTAGCAATGTAAGAAGG + Intronic
978936531 4:114383976-114383998 CTCATTGCAGGGGGGTATGAAGG + Intergenic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
982206307 4:152999651-152999673 CTCTTCACAGGGAGTTGAGATGG + Intergenic
982230814 4:153206672-153206694 CTGTTTCCAGGGAGCAAAGAGGG - Intronic
982370414 4:154627215-154627237 CTCTTTCCAGGGAGGAAAGGCGG + Intronic
983454041 4:167940487-167940509 TTCTTGGCAGGGAGGTTAGGAGG - Intergenic
984274660 4:177595547-177595569 TTCTTTGCAGGGACAAAAGAAGG + Intergenic
986648444 5:9940964-9940986 ATCTCTTCATGGAGGTAAGAAGG - Intergenic
986814382 5:11392229-11392251 TTCTTTAAAGGGAGGTAAAAGGG - Intronic
988153108 5:27413288-27413310 CTCTTTGGGAGGAGGTAAGTTGG + Intergenic
989668508 5:43886504-43886526 CTCCTTGCAGGGAACTAGGATGG + Intergenic
990415106 5:55578873-55578895 ATCTTCCCAGGGAGATAAGATGG - Intergenic
992338562 5:75798758-75798780 CACTGTGCAGGGAGCCAAGATGG - Intergenic
993167972 5:84382615-84382637 CTCTTAGCAGGAAGGGAAGGGGG - Intronic
993338667 5:86693816-86693838 CTCATTGCAGGGAAGCAGGATGG - Intergenic
994289202 5:98008178-98008200 TACTTTGCAGGGAGATAACATGG - Intergenic
996739661 5:126787310-126787332 CTAAGTGCAGGGAGGTAAGTAGG + Intronic
998377331 5:141699846-141699868 CTCTTTGGAGGGTGGAAAGGAGG + Intergenic
998740579 5:145196201-145196223 CTGTTTGCAGGGCTTTAAGAAGG - Intergenic
999847854 5:155505227-155505249 TTCTTTCCAGGGTGGTAGGATGG + Intergenic
999973869 5:156891714-156891736 CTCTGTGCAGAGAGGAAATATGG + Intergenic
1001764182 5:174232317-174232339 CTCTTTGCCAGGAGGTAAAGAGG + Intronic
1001919151 5:175586998-175587020 GTCTTGACAGGGAGGAAAGATGG + Intergenic
1002027005 5:176402576-176402598 CTCATGGCAGGGAGGGAAGGGGG - Intronic
1002045903 5:176541768-176541790 CTCTTTGGAGGGAGGTTTGAGGG - Intergenic
1002196686 5:177505002-177505024 CTCCTGGCAGGAAGGTAAGTTGG - Exonic
1004648253 6:17583656-17583678 CACCTTGCAGGGAGGTCAGGAGG + Intergenic
1005089716 6:22043610-22043632 GTCTTAGAAGGGAGGTGAGACGG - Intergenic
1005251478 6:23951118-23951140 CTCTTTGCAGAGAGCAAATATGG + Intergenic
1005318368 6:24626907-24626929 CAATTTGCAGGAAGGTAATAAGG + Intronic
1006180799 6:32152307-32152329 CACCTTGCAGGGAGCTAAGAGGG - Intronic
1006389136 6:33748328-33748350 CTCATTTCACAGAGGTAAGATGG + Intergenic
1007518252 6:42430376-42430398 CTTTTTGGAGTGAGGGAAGATGG - Intronic
1007994113 6:46288011-46288033 CTTCTTGCAGGGAGGGGAGAGGG + Intronic
1008052141 6:46911118-46911140 CTCTCTACAGAGAGGCAAGATGG + Intronic
1010807049 6:80249650-80249672 CTCTTGGGGTGGAGGTAAGAGGG + Intronic
1013957204 6:115855176-115855198 CTGTTTGCAGGGAGGTGTGGAGG + Intergenic
1014046241 6:116891350-116891372 CTCTTTTCAGCGTGGTAAAATGG - Intronic
1014703888 6:124722777-124722799 CTGTTTGCAGGAATGTAAAATGG - Intronic
1016279685 6:142401220-142401242 CACTTTGTAGGGAGCAAAGAAGG + Intronic
1019511432 7:1419561-1419583 CCCTCTGCTGGGAGGTAAGCAGG + Intergenic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1019941732 7:4297514-4297536 GTCTTTGCTGGGAGTTAAGCTGG - Intergenic
1022142864 7:27508379-27508401 CTCTTTGAAGAGAGGTAAGGGGG + Intergenic
1023174864 7:37426004-37426026 CTATTCTCAGGGAGCTAAGATGG + Intronic
1024279280 7:47706135-47706157 CCCTTTGCGGGGAGGGAAAAAGG + Intronic
1025225403 7:57155906-57155928 CTCTTGGCAGGGAAAAAAGAAGG - Intergenic
1026011231 7:66638232-66638254 CTCTAAGCAGGAAGGAAAGAGGG - Exonic
1026683632 7:72489688-72489710 CCCTTTGCATGAAGATAAGAAGG + Intergenic
1027287145 7:76658364-76658386 CTCTTAGAAGGGAGGCAACATGG - Intergenic
1028991149 7:97050603-97050625 CACATTGCAGGGAGGCAAGATGG + Intergenic
1030209992 7:106986657-106986679 CTCTTTGCAGGCAGGGAAGATGG + Intergenic
1031513356 7:122674211-122674233 CTGCTTGCAGGGAGGTGTGAAGG - Intronic
1032262445 7:130347942-130347964 CTCTTTGCAGGGACCTCAGGAGG - Intronic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1035990859 8:4488801-4488823 CTCTTTGCAGAGAGGAAATATGG - Intronic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1038663907 8:29520829-29520851 CTCCTTGCAGGGGGGTGAGGGGG + Intergenic
1039419687 8:37425783-37425805 CTCTTTGAAGGAAGTTAACAGGG - Intergenic
1042219338 8:66458275-66458297 TTATTTCCAGGGAGGTAGGAAGG + Intronic
1042989808 8:74626441-74626463 CTCTGTGGATGGAAGTAAGAGGG + Intronic
1043372569 8:79611778-79611800 TGCGGTGCAGGGAGGTAAGACGG + Intronic
1044429878 8:92095942-92095964 CTGTTTGGATGGAGGTGAGATGG - Intronic
1044524395 8:93235443-93235465 GTCTTTGCAGTGAGGTAAATAGG + Intergenic
1046003348 8:108447817-108447839 CTTTTTGCAGGAAGGTGAAAGGG + Intronic
1046164902 8:110419808-110419830 CATTTAGCAGGGAGGAAAGAGGG + Intergenic
1046216194 8:111151030-111151052 CTCTTTTAAGGCAGGTAAAATGG + Intergenic
1046869136 8:119185381-119185403 CTCTTTGCCGAGAGGCAATATGG - Intronic
1048935931 8:139357067-139357089 CTAGTTGAAAGGAGGTAAGAGGG + Intergenic
1049277989 8:141729458-141729480 AGCTTTGCAGGGAGGTAAGGAGG + Intergenic
1049437554 8:142594744-142594766 CTCCTGGCAGGGCGGCAAGATGG - Intergenic
1050029698 9:1372719-1372741 CTGTTTGCAGGGAGGTCAAGGGG + Intergenic
1050883623 9:10736733-10736755 CTCTTTGGAGGGCAGTAAGAAGG - Intergenic
1050998274 9:12247042-12247064 CCCTTCACAAGGAGGTAAGAAGG + Intergenic
1051715367 9:19977488-19977510 CTCTCTGCAGCAAGGTCAGAAGG + Intergenic
1052846207 9:33338732-33338754 CTCTTTGCAGAGAGGTTATGGGG - Intronic
1055500057 9:76894398-76894420 CTCTCTCCAAGGAGGCAAGAAGG - Intronic
1056379360 9:86043156-86043178 CTCATAGCAGGGAGATGAGATGG + Intronic
1057917341 9:99066799-99066821 ATCTTTGCAGGAATGTGAGATGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1061140718 9:128764615-128764637 CTCTGTGCCAGGATGTAAGATGG - Intronic
1061943346 9:133894566-133894588 CTCTGTCCAGGGAGGCATGAGGG + Intronic
1186374750 X:8987618-8987640 GTCTCTGCAGGGAGGTGAGGGGG + Intergenic
1186925691 X:14330842-14330864 CTGTTTTCAGGAAGGTAATAGGG - Intergenic
1187274892 X:17808576-17808598 GTCTTTTCTGGGAAGTAAGAAGG - Intronic
1187415871 X:19092880-19092902 TTCTTTGCAGGGAGTGAGGAGGG - Intronic
1188795706 X:34462012-34462034 CTATTTGCAGAAAGGTAAAATGG - Intergenic
1189974421 X:46447333-46447355 CTCTTGGCGGTGAAGTAAGAGGG + Exonic
1190032096 X:46983642-46983664 ATCTTTGCTGGGAGGGAAGATGG + Intronic
1192103074 X:68286419-68286441 CTCTTTGCAAGGAGGAGTGAAGG - Intronic
1194009508 X:88542738-88542760 ATCTTTGCAGGGAAAGAAGACGG + Intergenic
1197918387 X:131561006-131561028 CCCTTTGCATGGAGGGAAGGTGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1201260985 Y:12158754-12158776 CTGCTTGCAGGGAGGTATGGAGG - Intergenic