ID: 969224060

View in Genome Browser
Species Human (GRCh38)
Location 4:5782907-5782929
Sequence TCTCCTCAAAACCATCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969224060_969224067 27 Left 969224060 4:5782907-5782929 CCCTAATGATGGTTTTGAGGAGA 0: 1
1: 0
2: 1
3: 16
4: 163
Right 969224067 4:5782957-5782979 AGGAGAGCAGGTGTGAAGCTTGG 0: 2
1: 0
2: 4
3: 53
4: 381
969224060_969224065 7 Left 969224060 4:5782907-5782929 CCCTAATGATGGTTTTGAGGAGA 0: 1
1: 0
2: 1
3: 16
4: 163
Right 969224065 4:5782937-5782959 GTTAGAGAGCTCACTGTGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 162
969224060_969224066 15 Left 969224060 4:5782907-5782929 CCCTAATGATGGTTTTGAGGAGA 0: 1
1: 0
2: 1
3: 16
4: 163
Right 969224066 4:5782945-5782967 GCTCACTGTGGGAGGAGAGCAGG 0: 1
1: 0
2: 4
3: 28
4: 343
969224060_969224064 4 Left 969224060 4:5782907-5782929 CCCTAATGATGGTTTTGAGGAGA 0: 1
1: 0
2: 1
3: 16
4: 163
Right 969224064 4:5782934-5782956 AGAGTTAGAGAGCTCACTGTGGG 0: 1
1: 0
2: 0
3: 13
4: 150
969224060_969224063 3 Left 969224060 4:5782907-5782929 CCCTAATGATGGTTTTGAGGAGA 0: 1
1: 0
2: 1
3: 16
4: 163
Right 969224063 4:5782933-5782955 CAGAGTTAGAGAGCTCACTGTGG 0: 1
1: 0
2: 0
3: 32
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969224060 Original CRISPR TCTCCTCAAAACCATCATTA GGG (reversed) Intronic
900647211 1:3714421-3714443 TCTCCTCAAAGCCACCAGTCAGG + Intronic
901947095 1:12712795-12712817 TTACCCCAAAACCATCAATATGG - Intergenic
903395471 1:22998739-22998761 TTTCCTCCAAACCATCATAGTGG - Intergenic
907878646 1:58521487-58521509 TCTTTTCAAAACCATCTTTTGGG - Intronic
909720922 1:78768120-78768142 CCTCCTCAAAACCACCACTGGGG + Intergenic
910049973 1:82961839-82961861 TCTGCTCAAAACCATCACAATGG - Intergenic
910436838 1:87213842-87213864 TCTCCTCTGAATCATCGTTAGGG + Intergenic
912228580 1:107765254-107765276 TCTCTTTAAAACCATTGTTAGGG + Intronic
916170643 1:161999246-161999268 GCTCATCAAAAACACCATTAAGG + Intronic
920587553 1:207181937-207181959 TCTCCACAAAAACTTCATGATGG + Intergenic
921182959 1:212645872-212645894 TCTCCTCTCCACCATCACTAAGG - Intergenic
921527714 1:216238731-216238753 TTTCCTAAAAAACATTATTAAGG - Intronic
923225229 1:231933027-231933049 TATCCTCAACACCATCACTATGG - Intronic
923641168 1:235762411-235762433 TCTACCTAAAACCATCATTCTGG - Intronic
923848710 1:237768194-237768216 TCTCCTGAACACCATCTTCATGG - Intronic
1063836653 10:10022187-10022209 TTACCTCACAACCATAATTATGG - Intergenic
1064851243 10:19711175-19711197 TCTCCTTAAATGCATCCTTAGGG + Intronic
1065447020 10:25813372-25813394 TCTTCTCAAAACAATGTTTATGG + Intergenic
1067923888 10:50487937-50487959 TATCCTCAAAAACATGTTTAAGG - Intronic
1068073837 10:52229439-52229461 CCTCCTCAAAGCCATCATGAGGG - Intronic
1073130400 10:101185105-101185127 TTTCCTCCAAACCATCATAATGG - Intergenic
1073683955 10:105732572-105732594 TTTCCTTCAAACCATCATAAAGG + Intergenic
1074185116 10:111094403-111094425 TCCCCTCAATACCATCACCATGG - Intergenic
1074611191 10:115023792-115023814 TCTCCTATAAACCATCACTTTGG + Intergenic
1076212718 10:128661621-128661643 ACTTCTCAAAACCATCATAAAGG + Intergenic
1077553043 11:3211108-3211130 TCTCCTGAAAATTCTCATTAGGG - Intergenic
1078071798 11:8117920-8117942 GTTACTCAAAAACATCATTAAGG + Intronic
1078828882 11:14959798-14959820 TCTTCTCAAAATCATCTTAAAGG - Intronic
1079475842 11:20828461-20828483 GCTCCTCATACCAATCATTAAGG - Intronic
1079489194 11:20968733-20968755 TCCCCTCAAAACCATGATTCAGG + Intronic
1079835481 11:25328093-25328115 TTTCCTCCAAACCATCATAGTGG - Intergenic
1083525883 11:63364482-63364504 GCTTCTGAAAACCACCATTAGGG + Intronic
1085367659 11:75965946-75965968 TCTCCTCAAAACCAGGAACAAGG - Intronic
1086986976 11:93261430-93261452 TCACCTCAAAACCATCAAGATGG + Intergenic
1087916963 11:103822189-103822211 TCTCCCCAAACCCACCATAAAGG - Intergenic
1088095200 11:106091760-106091782 TCTCTTAAATACCCTCATTATGG - Intronic
1090758907 11:129818155-129818177 TCTCCCCAAAACCTTCACTGAGG + Intronic
1093412476 12:18883132-18883154 TCTGCTTAAAACCAACATTTTGG + Intergenic
1093619261 12:21267344-21267366 TCACCTCAAATCTATCAATAGGG + Exonic
1094264169 12:28536756-28536778 TCTGATCAAAATCATCATTTAGG - Intronic
1095321034 12:40827319-40827341 TCTCTTAAAAATCATCAATATGG - Intronic
1097637490 12:62140572-62140594 TCTCCTCTTAACCTTCATAAAGG + Intronic
1098587478 12:72171181-72171203 TCTCCTCAAAAGGAAAATTAGGG + Intronic
1098607681 12:72412751-72412773 TCTGCTCAAAGCTATCTTTATGG - Intronic
1098770300 12:74543015-74543037 TGTCCTCCAAAGCAACATTATGG - Exonic
1100527274 12:95431603-95431625 TCTCCTCATCATCATCATTTGGG - Intergenic
1101233818 12:102768077-102768099 TCTCCTTAAAACCAGCACTCAGG + Intergenic
1103323482 12:120104932-120104954 TCTCCTCAAATCCATCTTTCAGG - Intronic
1108870449 13:54977809-54977831 TCTCCTCAAAGACTTCATTGAGG + Intergenic
1113128689 13:107009830-107009852 TCTCATAAAAACATTCATTAAGG - Intergenic
1114712459 14:24792470-24792492 TCTCCTGAAGACCATCCTTCTGG - Intergenic
1116636554 14:47403706-47403728 TGTCCTGAACACCATCATTATGG - Intronic
1117174708 14:53134270-53134292 TTTCCTCCAAACCATCATAGCGG + Intronic
1118305193 14:64649705-64649727 TCGCCTCAAAAGCAACATAAGGG - Intergenic
1119680851 14:76591348-76591370 TCTCCTCCCAAGCATCATGAAGG + Intergenic
1121296449 14:92829458-92829480 ACTCCTCAAAGCCATCCTTGAGG - Intronic
1121696802 14:95920233-95920255 CCTCCTGAAAACCATTATTGTGG - Intergenic
1122495435 14:102151148-102151170 TCTCTTCAAAACCATCCATTGGG + Intronic
1124506053 15:30274867-30274889 ACCCCTCAAAATCATCCTTAGGG - Intergenic
1124737500 15:32263765-32263787 ACCCCTCAAAATCATCCTTAGGG + Intergenic
1129257072 15:74339597-74339619 CCTCCTCAAAGCCAGCATCAAGG - Exonic
1135609747 16:23855943-23855965 CCCCCTCAAAACCATCTATAGGG - Intronic
1136870840 16:33806535-33806557 TCTCCTCAAATCAATCAATTTGG - Intergenic
1140263385 16:73399737-73399759 TCTTCTGAAAATCATAATTAGGG - Intergenic
1203101332 16_KI270728v1_random:1309523-1309545 TCTCCTCAAATCAATCAATTTGG + Intergenic
1146680888 17:34807404-34807426 TCTCCCCAAAGCCATCATTATGG + Intergenic
1147378314 17:40036115-40036137 TGTCCTCACAGCCATCAGTAAGG - Exonic
1149701778 17:58661383-58661405 TCTCCTCCAAATCTTCATTTCGG + Intronic
1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG + Intergenic
1153479864 18:5536358-5536380 TCACATCAACACCATCATTAAGG + Intronic
1155452989 18:25982484-25982506 TCTTCTCAAATCCATCACGAGGG + Intergenic
1155951413 18:31917535-31917557 TCTCCTCAAATCAAATATTATGG - Intronic
1156153590 18:34273136-34273158 TCTTCCCAAAACTATCATTCAGG + Intergenic
1162195234 19:8979582-8979604 GCACCTCAAAAGCATCATCATGG - Exonic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
926406221 2:12555528-12555550 GCACCTCAAATCCCTCATTAGGG - Intergenic
927358364 2:22202248-22202270 GCTCCTCAAAAGCATCCTTTTGG - Intergenic
929521593 2:42657558-42657580 TCCCCTCAAAGCCAGCATGAAGG + Intronic
931144598 2:59503412-59503434 ACTGCTCAAAATCATCATCAAGG + Intergenic
933079881 2:77972633-77972655 CCTCCCCAAAACCATCTTAATGG + Intergenic
933522204 2:83388471-83388493 TCTCCTGAAAAATCTCATTATGG + Intergenic
935040785 2:99424970-99424992 TCACCACAAAACTATAATTATGG + Intronic
935886298 2:107623415-107623437 TATCTTCAAAACCAGCAGTAGGG - Intergenic
936759507 2:115759074-115759096 TCTCATCAAAGACACCATTAGGG + Intronic
940177269 2:150892263-150892285 TCTCCTTAATTCCATGATTATGG - Intergenic
941282090 2:163565153-163565175 AATCATCAAGACCATCATTATGG + Intergenic
941844354 2:170118494-170118516 TCTCCTCAATACCATGATGCTGG - Intergenic
943694134 2:190905380-190905402 TCTCTTCATAACCACCTTTAGGG + Intronic
947457406 2:230267876-230267898 CCTCATCAAAACCTTCATGAGGG - Intronic
1171964875 20:31522153-31522175 TCACCTACAAACCAGCATTATGG - Intronic
1175299367 20:57932181-57932203 TGTCCTCAAAACCATCCCTCGGG + Intergenic
1177888159 21:26771112-26771134 TCTCCTCAAAACCATTCATTAGG - Intergenic
1181566353 22:23741097-23741119 TCTCCTTAAAACCAACTTTCAGG - Intergenic
1182939475 22:34261645-34261667 TCTCCTGAAAAGCATCCTTTGGG + Intergenic
1183262469 22:36804471-36804493 TCCCCTCAGAACCTTCAATAGGG + Intronic
949144755 3:685091-685113 TCTCCAAAAAACCATCTTTTTGG + Intergenic
950663096 3:14479095-14479117 TGTCCTCAATACCATCATAAAGG - Exonic
951004002 3:17596158-17596180 TAGCCTAAAAACCATCAGTAGGG + Intronic
951424380 3:22526335-22526357 TCTCATCATGATCATCATTAAGG - Intergenic
951949138 3:28179725-28179747 TCTCCTTATTGCCATCATTATGG - Intergenic
952860873 3:37811321-37811343 TCTCTTCAAGACAATCATAAAGG + Intronic
953840819 3:46388954-46388976 TTTCCTCCAAACCATCATAGTGG - Intergenic
958693188 3:97494537-97494559 TCTTCTCACAACAATCATGAAGG - Intronic
959209363 3:103357192-103357214 TCCCCTCAATACCATCTTTCAGG - Intergenic
962431049 3:135320225-135320247 TCTTCTCAATACCTTAATTAAGG + Intergenic
962476485 3:135759633-135759655 GCTCCTCAGGACAATCATTAGGG - Intergenic
964798541 3:160527531-160527553 TCTTCTCAGAACTGTCATTACGG + Intronic
966671304 3:182529442-182529464 TGTCATCAAAAGCATCATTGTGG + Intergenic
967247783 3:187505443-187505465 TCTCTGCAAAGACATCATTAAGG - Intergenic
969224060 4:5782907-5782929 TCTCCTCAAAACCATCATTAGGG - Intronic
969887263 4:10226273-10226295 TCTCCTCACTTCCATCATTATGG - Intergenic
970679429 4:18489759-18489781 TCTCCTCAGAACCAGCAGGAAGG - Intergenic
971690485 4:29827878-29827900 TTTCTTCAAAACAATCATTTTGG - Intergenic
973797649 4:54444674-54444696 TCTTCTCAAAACTATAATGAAGG + Intergenic
974167958 4:58228444-58228466 TCTCATCAAAACCATTATAGGGG + Intergenic
975840855 4:78472266-78472288 TCTCCACAAAGCCATGCTTAGGG - Intronic
978165661 4:105603522-105603544 TCTCCCCAACACCACCATCATGG - Intronic
980178760 4:129378730-129378752 TTTCCTCTAATCCTTCATTAGGG - Intergenic
980749053 4:137064897-137064919 TCTCCTTGAAACCATCACAATGG - Intergenic
981155533 4:141430716-141430738 AATCCTCAAAACAATCATTTAGG + Intergenic
983472150 4:168170509-168170531 TCTTCTCCAAACCATGATTCAGG + Intronic
985127172 4:186706241-186706263 TATTATCAAAAGCATCATTATGG - Intronic
987561526 5:19529446-19529468 TCTCCTGAACACTATCTTTAGGG + Intronic
989413434 5:41146120-41146142 TCATCTTAAAACCATCATCATGG + Intronic
992836104 5:80643090-80643112 ACCCCTCAAAGCCATCATGAGGG - Intronic
992937165 5:81719761-81719783 TCTGCTGAAAACCATAATAAAGG - Intronic
993233617 5:85272823-85272845 ACTCCTCAAAAGCATAATTTTGG + Intergenic
994603120 5:101933208-101933230 TTTCCTCAGACACATCATTAAGG + Intergenic
996235383 5:121123247-121123269 TTTTCTCAAAACCCTTATTAAGG + Intergenic
997001987 5:129772402-129772424 TGTCCTAGAAACCATCTTTAGGG - Intergenic
997719089 5:136063908-136063930 TCTCCCCAAAACCATCCCTCGGG - Intergenic
999594353 5:153185505-153185527 TCACCCCCAAACCATTATTATGG - Intergenic
999925882 5:156376708-156376730 TCTCCTAAAAAGTATAATTAAGG - Intronic
1000098249 5:157989864-157989886 GCTCCTCAACACCATCATCAAGG - Intergenic
1000709491 5:164553867-164553889 ATTCCTCCAAACCATCATGATGG - Intergenic
1001560798 5:172667767-172667789 TCTGCTCTAAACCTTCAATAAGG + Intronic
1005316165 6:24604683-24604705 TCTTCTCAATACCATATTTAAGG + Intronic
1005457260 6:26033028-26033050 ACACCTCAAAAACATCTTTATGG + Intergenic
1006656257 6:35596051-35596073 TCACCTCAAAAATATGATTATGG + Intronic
1008169092 6:48180533-48180555 TCTCCCCAAAGCTATCATTCTGG + Intergenic
1011437036 6:87349363-87349385 TTTCCTCAAATGCTTCATTATGG + Intronic
1011663949 6:89617421-89617443 TCTCCTGAGAACCTACATTATGG + Intronic
1013874540 6:114807616-114807638 TCTCATCATTACCAACATTAAGG + Intergenic
1018065514 6:160122745-160122767 CCACCTCAACACCATCATTGAGG - Intronic
1018731341 6:166653359-166653381 CCTCCTTAAAAACATTATTAGGG - Intronic
1021569204 7:22047284-22047306 TCTCTTTAAAACCATCTCTAAGG + Intergenic
1022682242 7:32559744-32559766 TCTCCTTAAAAACAGAATTAAGG + Intronic
1022733164 7:33050953-33050975 TCTCCTTAAAAACAGCAGTAGGG - Intronic
1024503169 7:50135317-50135339 TGTACTCAAAAACTTCATTATGG - Intronic
1027696141 7:81413081-81413103 TCTCCTCAAAGCCATCAGTTTGG + Intergenic
1028464187 7:91131269-91131291 TCTTCTCCAAAACATCATGAGGG - Intronic
1029875703 7:103749202-103749224 TCTCCTCAAAGCCATGAGTGTGG - Intronic
1030098614 7:105923938-105923960 TATCCTCCTAACCAGCATTATGG - Intronic
1030483769 7:110139705-110139727 TCTCCTCAAAGTCATCCATAAGG - Intergenic
1032667334 7:134049631-134049653 TCTCCTCCAGACCTTTATTATGG + Intronic
1033478151 7:141710871-141710893 TCTACTCAAAACCATGGTAATGG - Intronic
1033933011 7:146547507-146547529 GCTCCTGGAAACCACCATTATGG + Intronic
1033965113 7:146965922-146965944 TCTCCTCTAAAATATCATTATGG + Intronic
1034785727 7:153924406-153924428 CCTCCTCAAAACCCTCAATGAGG - Intronic
1035550546 8:520631-520653 TCACCTCACAACCATTAGTATGG - Intronic
1041897822 8:62946508-62946530 TCTCCTAAAAGCCTTCATTATGG + Intronic
1042145776 8:65729204-65729226 TATCTGCAAAGCCATCATTAGGG + Intronic
1043255352 8:78129696-78129718 TCTCATCTAAACCATATTTAGGG - Intergenic
1044062769 8:87660171-87660193 TGACTTCAAAATCATCATTAAGG + Intergenic
1044598254 8:93979234-93979256 TCACCCCAAACCCATCATTGAGG - Intergenic
1046851743 8:118982262-118982284 TCTTCTGAAAACCATATTTAAGG - Intergenic
1047044354 8:121034940-121034962 TTTCCTCAAAACAATTATTTTGG - Intergenic
1057640319 9:96813594-96813616 TCTCCTCATTACCATAATAATGG - Intergenic
1058439069 9:104991115-104991137 TCTTCTGAAAACCATCACTGAGG + Intergenic
1059513408 9:114870301-114870323 TCTCTTCAAAGCCATCAGGAAGG - Intergenic
1059763243 9:117359254-117359276 AATCCTCAAAACAACCATTAAGG - Intronic
1060276376 9:122186039-122186061 CCTCCACAAAGCCTTCATTACGG - Intronic
1062004133 9:134230821-134230843 TGCCCTCAGCACCATCATTACGG + Intergenic
1062304879 9:135899908-135899930 CCTCCTCAAGCCCGTCATTATGG + Intronic
1187054450 X:15729112-15729134 TCTCCTGAAAACAAACATAAAGG - Intronic
1187575577 X:20550786-20550808 TCTCCTTAAAATTATCATGAGGG - Intergenic
1188731458 X:33651099-33651121 TCTTTTCCAAACCATCATCATGG - Intergenic
1188798794 X:34500816-34500838 TCTCAAAAAAGCCATCATTAAGG + Intergenic
1192055096 X:67765915-67765937 TCTCCTCAAAACCATTCACAGGG + Intergenic
1195901911 X:109807974-109807996 TCCCTTCAAAATCATCATTTTGG - Intergenic
1201469741 Y:14320014-14320036 TCTCCTAAATACCTTCTTTAGGG + Intergenic