ID: 969226563

View in Genome Browser
Species Human (GRCh38)
Location 4:5802340-5802362
Sequence TAGGATACTGAGATGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969226557_969226563 21 Left 969226557 4:5802296-5802318 CCAGTGCAGTGGGAGTGTTTTAA 0: 1
1: 0
2: 0
3: 8
4: 143
Right 969226563 4:5802340-5802362 TAGGATACTGAGATGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969226563 Original CRISPR TAGGATACTGAGATGGAGTC AGG Intronic
No off target data available for this crispr