ID: 969227774

View in Genome Browser
Species Human (GRCh38)
Location 4:5810374-5810396
Sequence CCCCAGGAAAGAGGGGACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969227759_969227774 21 Left 969227759 4:5810330-5810352 CCTCTACAGAGAAGCCCCTAAGG 0: 1
1: 0
2: 0
3: 9
4: 206
Right 969227774 4:5810374-5810396 CCCCAGGAAAGAGGGGACCTGGG 0: 1
1: 0
2: 5
3: 36
4: 314
969227764_969227774 5 Left 969227764 4:5810346-5810368 CCTAAGGACTAAAAGGAAGAAGC 0: 1
1: 0
2: 0
3: 23
4: 251
Right 969227774 4:5810374-5810396 CCCCAGGAAAGAGGGGACCTGGG 0: 1
1: 0
2: 5
3: 36
4: 314
969227762_969227774 7 Left 969227762 4:5810344-5810366 CCCCTAAGGACTAAAAGGAAGAA 0: 1
1: 0
2: 0
3: 33
4: 299
Right 969227774 4:5810374-5810396 CCCCAGGAAAGAGGGGACCTGGG 0: 1
1: 0
2: 5
3: 36
4: 314
969227763_969227774 6 Left 969227763 4:5810345-5810367 CCCTAAGGACTAAAAGGAAGAAG 0: 1
1: 0
2: 4
3: 34
4: 357
Right 969227774 4:5810374-5810396 CCCCAGGAAAGAGGGGACCTGGG 0: 1
1: 0
2: 5
3: 36
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969227774 Original CRISPR CCCCAGGAAAGAGGGGACCT GGG Exonic
900197869 1:1386218-1386240 CCTCAGGAACGAGAGCACCTTGG + Intronic
900389850 1:2429106-2429128 CCCCAGGAAGGAGGGCCCCTTGG - Intronic
902787988 1:18745449-18745471 CTCCAGCAAAGAGGGGACCCTGG + Intronic
903269363 1:22178036-22178058 CCCAAGGAAAGCAGGGTCCTGGG - Intergenic
903666773 1:25012865-25012887 CCCCAGGAAAGAGTGGACTGTGG - Intergenic
903669763 1:25028470-25028492 CCCCAGGAAAGATGGGAGCTGGG + Intergenic
903826361 1:26148416-26148438 TCCCAGGCAAGAGGGGACGGTGG + Intergenic
903859082 1:26354386-26354408 CCCCAGGGCAGAGGGGACAAAGG - Intergenic
903953812 1:27011702-27011724 CCTCAGGAGAGAGAGGACGTGGG + Intronic
904410539 1:30322264-30322286 CCCCAGGAAAGGTGGGACAGAGG + Intergenic
904570469 1:31460379-31460401 CCCCTGAAAAGAGGATACCTAGG - Intergenic
904593581 1:31628834-31628856 GCCCAGGGAAGAGAGGACTTGGG + Intronic
904657954 1:32063341-32063363 CACCAGGAAAGAGGTGAGGTGGG - Intergenic
904714498 1:32457118-32457140 CCCCAGGAAAGAGAGGGAATGGG + Intergenic
905265591 1:36752570-36752592 CCCCAGGACAAAGGAGACCCAGG + Intergenic
910318696 1:85919376-85919398 CCACAAGAAAGAGGGGGCCTGGG + Intronic
912517393 1:110224954-110224976 CCCCGGGAATGAGTGGACCCGGG - Intronic
913074775 1:115332741-115332763 CTCCAGGAAAGTGGAGACATAGG - Intronic
914717731 1:150266119-150266141 CCCGAGGACTGAGGGAACCTAGG - Exonic
914870592 1:151470587-151470609 CCCCAGGAAAGCGGGGCCTCAGG + Intergenic
915318456 1:155042948-155042970 GCACAGGAAAGAGGTGACCAGGG + Intronic
918370090 1:183852368-183852390 GCACAGGAAACAGGGGTCCTTGG - Intronic
919731734 1:200917058-200917080 CCTCTGGGAAGAGGGGACCTCGG + Intergenic
920968469 1:210721870-210721892 CCACAGGAAAGAGGACAGCTGGG - Intronic
920972645 1:210755772-210755794 CCCTAGGAAAGTGGGGATCTGGG - Intronic
921039558 1:211416735-211416757 CCCCAGGAAGGAGAGGGCCACGG - Intergenic
921048812 1:211496243-211496265 CCCCAGGTAGGAGGGGACTCTGG - Intergenic
1064061978 10:12145914-12145936 CCCCAGGAAGAAGGGGAGCAAGG + Intronic
1065407906 10:25389317-25389339 CCTCAGCAAAGAGGAGACCCTGG - Intronic
1067796315 10:49324639-49324661 CCTCAGGAGAGAGGGGCCCTGGG - Exonic
1067904650 10:50278253-50278275 GTCCTGGAAAGAGGGGAACTGGG - Intergenic
1069793802 10:71039943-71039965 ACCCAGGGAAGCAGGGACCTGGG - Intergenic
1070590987 10:77800845-77800867 CCCTAGGGAAGAGCGGCCCTAGG + Intronic
1073243464 10:102073287-102073309 ACCCAGAAGAAAGGGGACCTGGG + Intergenic
1075342883 10:121661496-121661518 CCCCAGGAAGGAGGGCTCCCAGG + Intergenic
1075362871 10:121855147-121855169 CCACAGCAGAGAGGGGGCCTGGG - Intronic
1075993888 10:126860861-126860883 GCCCAGGAAAAAGGGGACAGTGG - Intergenic
1076619788 10:131779820-131779842 CCCCAGCACAGAGGGCTCCTGGG + Intergenic
1076839419 10:133038727-133038749 ACCCAGGAGAGAGGTGACCCAGG - Intergenic
1077868364 11:6241140-6241162 CCCCAGAGAGGAGGGGCCCTTGG + Intronic
1078513286 11:12002719-12002741 TCCCAGGAAAGGGTGGAGCTGGG + Intronic
1079114786 11:17634249-17634271 CCCCAGGCAGCAGGGGTCCTTGG - Exonic
1080600876 11:33819773-33819795 GGCCAGGTGAGAGGGGACCTCGG - Intergenic
1080642932 11:34168243-34168265 CCCCATGGCAGAGGAGACCTTGG - Intronic
1081735358 11:45399725-45399747 CTCCAGGAAGGAGAGGGCCTGGG - Intergenic
1081842582 11:46213712-46213734 AACCAAGAAAGAGGGGGCCTGGG - Intergenic
1082077572 11:47986177-47986199 AAGCAGGAAAGAGGGCACCTGGG - Intronic
1084072148 11:66743773-66743795 CCCCCGCAAAGGTGGGACCTGGG - Intergenic
1084171665 11:67404051-67404073 CCCCATAAAAGAGGAGACATAGG + Intronic
1084456432 11:69270485-69270507 CCCCTGGGAGGAGGGGACCCAGG - Intergenic
1084617024 11:70243263-70243285 CCCCAGGCAGGAGGGGTGCTGGG + Intergenic
1084622328 11:70281421-70281443 CGCCAAGAAAGAGGGGCCCTGGG - Intronic
1085023790 11:73224973-73224995 CCACTGGAAAGAGGAGAACTCGG + Intronic
1085127451 11:74011318-74011340 CCCAAGGGAAGTGGGGCCCTGGG + Intergenic
1085265831 11:75237384-75237406 TCCCAGGAGAGAGGGATCCTAGG + Intergenic
1086492858 11:87372882-87372904 CCCAAGGGAATAGGGAACCTTGG + Intergenic
1087689260 11:101300614-101300636 CCCCAGGAAGAATGTGACCTAGG + Intergenic
1088992268 11:114963840-114963862 GACCAGGCAAGAGGTGACCTTGG + Intergenic
1089004842 11:115082757-115082779 CCCATGGAAAGAGGAGACCCTGG + Intergenic
1090060555 11:123460922-123460944 GCCCAGGAAAGAGGCGCCCAAGG - Intergenic
1090900513 11:131026741-131026763 CCCTAGGAAGGAGGGTGCCTAGG + Intergenic
1091265886 11:134270681-134270703 GCCCAGGAAAGATGGGGCCTGGG + Intergenic
1091879539 12:3965758-3965780 CCACAGGAAGGATGGGACCTTGG + Intergenic
1092084133 12:5741821-5741843 CCCAAGGTAACAGGGCACCTTGG + Intronic
1092180769 12:6445226-6445248 AGCCAGGTAAGAGGGGGCCTTGG + Exonic
1093991067 12:25590799-25590821 CTCCAGGAAAGGGAGGACCCTGG + Intronic
1094224127 12:28026630-28026652 CCCCAGGAAAGATGGGGCAAGGG + Intergenic
1094357658 12:29595542-29595564 GCCCAGGAAGGGAGGGACCTGGG - Intronic
1096069568 12:48767444-48767466 CCACAGGAGAGAGGCAACCTGGG + Exonic
1100613955 12:96216295-96216317 CCTCAGCAAAGAGGGTCCCTGGG - Intronic
1101613573 12:106314481-106314503 TCCCAGAAAAGAGGTAACCTGGG + Exonic
1102350549 12:112188825-112188847 CCCCAGCAGAGAGGGGAGCAAGG - Intronic
1102456402 12:113073487-113073509 CCCCAGGAAATAAGGTCCCTGGG - Intronic
1103851128 12:123934345-123934367 CCCCAGGAATGAGGATTCCTGGG + Exonic
1104747160 12:131218041-131218063 CCCAAGGAAAAAGTGAACCTCGG - Intergenic
1105040213 12:132955829-132955851 CCCCAGGGGAGAGGGGCCCCTGG - Intronic
1106846677 13:33744453-33744475 CTTCAGAAAAGATGGGACCTTGG + Intergenic
1110986611 13:81978568-81978590 CACCAGCAGAGAGAGGACCTGGG - Intergenic
1112328079 13:98457138-98457160 CCCCAGCCCAGAGGGGCCCTGGG + Intronic
1112332131 13:98484822-98484844 CTCCAGGAAGGAGGCGGCCTTGG - Intronic
1113730676 13:112638990-112639012 GAACAGGAAAGAGGGGCCCTAGG - Intergenic
1115097156 14:29650444-29650466 CCCCGGGACAGAGGAGACCTGGG - Intronic
1118796679 14:69151684-69151706 CCCCAGGGAGGAGGGGACGACGG + Intronic
1119195506 14:72714354-72714376 GCACAGGGAAGAGGGGCCCTGGG + Intronic
1121691172 14:95877896-95877918 CCCCAGGAAAGAGAACACCTAGG - Intergenic
1122880252 14:104687680-104687702 CCCCAGGCAGGAGCGGCCCTGGG + Intergenic
1122886449 14:104712548-104712570 CTCCAGGCAAGTGGGCACCTGGG + Exonic
1123043416 14:105499759-105499781 CCCCAGAAGAGAGGGGAGCCCGG - Intergenic
1123996243 15:25719719-25719741 CCCCAGGAAAGATGAGGCCCAGG + Intronic
1125604268 15:40931144-40931166 CCCCAGGCTAGAGAGGACCCTGG - Intronic
1126466043 15:48962639-48962661 CTCCAGGAAAGCCGGGACCCAGG - Exonic
1127375795 15:58383330-58383352 ACCCAGGAAACAGGAGACCCTGG + Intronic
1128247604 15:66143754-66143776 CCCCAGGACTCAGGGGACTTTGG + Intronic
1128543292 15:68551488-68551510 CCTCAGGAAAGAGGAGGCCGGGG - Intergenic
1129028933 15:72604778-72604800 CCCCAGGAAAGAGGGTTCAGTGG + Intergenic
1129115481 15:73363190-73363212 GCCCAGCAAAGAAGGGGCCTCGG + Intronic
1129387789 15:75205398-75205420 TCCCAAGAAGGAGGGGATCTTGG + Intronic
1129727585 15:77909419-77909441 CCCCAGGCAAGAGGTGGCCCTGG + Intergenic
1129910361 15:79221451-79221473 CCCCAGGGGAGAGAGGACCGAGG - Intergenic
1130376572 15:83334482-83334504 CCCCAGGCAAGATTAGACCTGGG - Intergenic
1130785010 15:87086361-87086383 CACTAGGTAAGAGGGGGCCTTGG + Intergenic
1130871660 15:87976799-87976821 CCCAAGGAAAGACGGGGCTTTGG - Intronic
1130906533 15:88244543-88244565 CCCCAGAGAAGATGGCACCTGGG + Intronic
1130978429 15:88795019-88795041 CAACAGGAAAGTGGGGAACTGGG - Intergenic
1130992831 15:88886867-88886889 CCCCAGTGGAAAGGGGACCTGGG - Intronic
1131873048 15:96780104-96780126 CCCAAGGGAAGTGGGCACCTGGG + Intergenic
1132379688 15:101358006-101358028 CCCCTGGAAGGAGGGGAGTTAGG + Intronic
1132690834 16:1181152-1181174 ACCCAGCCAGGAGGGGACCTTGG - Intronic
1132903983 16:2272770-2272792 CCCCAGGACTCAGGTGACCTTGG - Intergenic
1133028472 16:2998663-2998685 CCCCAGGAGAGTGTGGACCAAGG + Intergenic
1133323893 16:4931714-4931736 GCCCTGGAAGTAGGGGACCTGGG - Intronic
1133419388 16:5632899-5632921 GCCCAGGAATCAGGTGACCTGGG - Intergenic
1134855230 16:17513142-17513164 CCCCAAGAAAGGCGTGACCTGGG - Intergenic
1136274422 16:29169987-29170009 GCCCAGGAAAGAGGGGCCCCGGG - Intergenic
1138445318 16:57059599-57059621 GCCCAGGGAAGAGGGGGCCATGG - Intronic
1139513597 16:67440856-67440878 TCCCAGGAATGAGAGGGCCTGGG + Intronic
1139779686 16:69340121-69340143 ACCCAGGGGAGAGGGGTCCTGGG + Intronic
1139961781 16:70722115-70722137 TCCCAGGAGAGTGGGGGCCTTGG - Intronic
1140654571 16:77126200-77126222 CCCCAGGAAAGAGACTACATAGG - Intergenic
1141633401 16:85301247-85301269 GCCCAGGAAAGTGGTGCCCTTGG + Intergenic
1142078704 16:88135633-88135655 GCCCAGGAAAGAGGGGCCCCGGG - Intergenic
1142212500 16:88815138-88815160 CCCCAGGAATCATGGGAACTTGG + Intronic
1143057869 17:4175936-4175958 CCCCAGGAAGGCGGGGTCCTTGG + Intronic
1143381049 17:6496545-6496567 CCCCAGGAAAGAGAGGACCGTGG - Intronic
1143382398 17:6504478-6504500 CCCCAGGATTCAGGGGACGTGGG - Intronic
1146691525 17:34879546-34879568 CTCCATGCAAGAGGGCACCTGGG + Intergenic
1148685331 17:49497485-49497507 CCCAAGGAAGGAGGGGAGCTGGG + Intronic
1151716294 17:75832804-75832826 GCCCAGGAAAGAGGGGCCGTGGG + Intronic
1151716325 17:75832894-75832916 GCCCAGGAAGGAGGGGCCGTGGG + Intronic
1151906784 17:77054115-77054137 CCTCAGGACACAGGGAACCTAGG + Intergenic
1151961704 17:77409149-77409171 CCCAAAGTAAAAGGGGACCTGGG - Intronic
1152086744 17:78224517-78224539 TCCAAAGAAAGCGGGGACCTGGG - Exonic
1152225065 17:79089057-79089079 AACCAGGAAAGAAGGGACCAGGG + Intergenic
1152282260 17:79391891-79391913 AACCGGGAAGGAGGGGACCTGGG - Intronic
1156487079 18:37473128-37473150 AGCCAGGAAGGAGGGGACCAGGG - Intronic
1156521078 18:37722804-37722826 CCCCAGGAAAGAGGGTGTCCTGG - Intergenic
1156637512 18:39049184-39049206 CCCCAGCAGAGAGGGGAAGTTGG + Intergenic
1157554924 18:48607201-48607223 CTCCAGGAATCAGGGGCCCTGGG + Intronic
1157745427 18:50130902-50130924 CCCCTGGAAGGAGAGGAGCTTGG - Intronic
1161108336 19:2455499-2455521 CCCCACCAAAGAGAGGTCCTGGG - Intronic
1161470232 19:4453583-4453605 CCCCGGGAATGAGGGGGCTTGGG - Intronic
1161708014 19:5831296-5831318 CCCCAGGAAAGTGAGGACCCAGG + Exonic
1161854278 19:6754508-6754530 CCCCAGGGAAGAAGGGAGATGGG - Intronic
1162017617 19:7853856-7853878 CCCCAGGAACCAGGGGCCCCGGG - Intronic
1162704580 19:12545858-12545880 CCCCAGGAAAGAGTGGAGGCTGG - Intronic
1162746227 19:12800268-12800290 CCCCCGGAAAGAGGGAGGCTTGG - Exonic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1163080017 19:14932333-14932355 ACCCAGGGAAGAAAGGACCTAGG + Intergenic
1163547872 19:17950222-17950244 CTCTAGGGAAGAGGCGACCTTGG + Intergenic
1163583785 19:18153433-18153455 CCGCAGGCAAGGGGGGGCCTCGG + Intronic
1163654489 19:18537890-18537912 CCCCAGGAAAGCGTGGCCCTTGG - Intronic
1165097600 19:33418067-33418089 CCCCGGGAAGGCGGGGACCCTGG - Intronic
1165125781 19:33596111-33596133 CCATAGGAAAGAGGGGATGTAGG - Intergenic
1165819610 19:38666165-38666187 CCCCAGGAAAGGGGGGGGCGCGG - Intronic
1167008139 19:46788457-46788479 CCTCCGGAAACAGGGGACCCAGG + Exonic
1167335762 19:48884827-48884849 CCCAAGAAATGAGGGGGCCTGGG - Intronic
1167403675 19:49289934-49289956 CACCAGGTAAGATGGGACCCAGG + Exonic
1167862853 19:52298898-52298920 ACCCAGAAAAGAGGGAACCCTGG + Intronic
1168707620 19:58478915-58478937 CCCTAGGAGAGAAGGGACTTCGG - Intronic
926367422 2:12145909-12145931 CAGCAGGAGAAAGGGGACCTGGG + Intergenic
926457760 2:13089539-13089561 CACAAAGAAAGAGGGAACCTTGG - Intergenic
929928907 2:46237086-46237108 CATGAGGACAGAGGGGACCTGGG - Intergenic
930590083 2:53316599-53316621 CCACAGGATGGAGGGAACCTGGG + Intergenic
931253919 2:60554414-60554436 GGCCTGGAAAGAGGGGACCGGGG + Intergenic
931721692 2:65071761-65071783 CTCCAGGGAGGAGGAGACCTTGG - Exonic
932590551 2:73064122-73064144 CCCCAGGGAAGAGCAGGCCTTGG + Intronic
933012658 2:77087916-77087938 CCTCTGGAAAAAGGGAACCTTGG - Intronic
933103298 2:78287666-78287688 TCTCAGCAAAGAGGGGACATGGG - Intergenic
933805886 2:85997813-85997835 CCCCAGGAGGGAGGGGCCGTTGG + Intergenic
935072591 2:99708482-99708504 CCCCAGGCAACATGGGACCTTGG + Intronic
936502134 2:113074762-113074784 CCCCAGGAAAATGGGGACCTTGG - Exonic
936960554 2:118069360-118069382 TCCCAGGAAAGAGGGTTCTTTGG + Intergenic
938618184 2:133021269-133021291 CCCCAGGAAGGAGCGAATCTGGG + Intronic
941180624 2:162254919-162254941 CCCCAGGAAGGTGAGTACCTTGG + Intergenic
941492795 2:166163326-166163348 CACCAGGAAGGACGTGACCTTGG - Intergenic
944446707 2:199799077-199799099 CCCCAGGCAGGAGGGAACCCTGG - Intronic
945059106 2:205892965-205892987 CCCAAGGCAAGAGGAGGCCTCGG + Intergenic
946415660 2:219538543-219538565 CCCCTGCCAAGAGGGGAGCTGGG - Exonic
946961350 2:224988972-224988994 CCCCAGAAAAGAGGCTACTTTGG + Intronic
947788792 2:232849848-232849870 CCCCAGGACAGAGAGGACAGGGG - Intronic
948421384 2:237862716-237862738 CGTCAGGAAAGAGGGGTTCTAGG - Intronic
948884136 2:240874564-240874586 CCCCAGAACAGAGAGGACTTCGG + Intronic
1170552772 20:17491382-17491404 CCTCAGGGAAGAGGAGACCGAGG + Intergenic
1170642166 20:18164157-18164179 TCCCAGGAAAGATGGGAATTAGG - Intronic
1170864766 20:20143385-20143407 TCCCAGCAAAGAGGGGACTCGGG + Intronic
1171297924 20:24034911-24034933 CACCAGCACAGATGGGACCTGGG - Intergenic
1171512303 20:25696020-25696042 CCCCAGGGAAGAGGCCACCTGGG + Intronic
1172573326 20:35987158-35987180 CAGCAGTAAAGAGGGGAGCTTGG + Intronic
1172620252 20:36313826-36313848 CCCCAGGCAAGAGGCCAGCTGGG + Intronic
1172801937 20:37581975-37581997 CCCCATGAAAGAGGGAAGCCCGG - Intergenic
1173251155 20:41364863-41364885 CCCCAGAAAAGAGGGTGCCAAGG - Intronic
1173478777 20:43382987-43383009 CCCCAGAAAAGAGGGGAGCTGGG - Intergenic
1174819296 20:53713354-53713376 CTGCAGGAAGGAGGGGACCTGGG - Intergenic
1175948169 20:62568336-62568358 CCTCAGGAATGAGCGGCCCTTGG + Intronic
1176110182 20:63407499-63407521 TCCCAGGAAACGGGGGACCCAGG + Intronic
1176110221 20:63407611-63407633 TCCCAGGAAATGGGGGACCCAGG + Intronic
1176169715 20:63691304-63691326 CCCCAAGGAAGAAGGAACCTGGG - Intronic
1180001287 21:44996677-44996699 CCACAGGGAACAGGGGACCAGGG - Intergenic
1180831511 22:18909334-18909356 CCCCAGGAAGGAGGGGTCCCTGG - Intronic
1180981488 22:19880069-19880091 CCCCTGGAAAGGAGAGACCTTGG + Intronic
1181035826 22:20169367-20169389 CCCCAGGAGAGAGGGAACCCTGG + Intergenic
1181054013 22:20251199-20251221 GGCCTGGAAAGAGGTGACCTGGG + Intronic
1181068335 22:20317033-20317055 CCCCAGGAGGGAGGGGTCCCTGG + Intronic
1181339433 22:22166213-22166235 CCCCGGGAGAGTGTGGACCTGGG - Intergenic
1181969826 22:26681625-26681647 CCCCAGGAAAGAGAACATCTTGG + Intergenic
1182422585 22:30255880-30255902 CCCCAGGAAAGCTGGGCCCAGGG + Intergenic
1183616860 22:38950870-38950892 CCCCAGGGGACAGGGGGCCTGGG + Intergenic
1184288686 22:43486711-43486733 CCCCGGGAAATGGGGGCCCTGGG + Intronic
1184458457 22:44624385-44624407 CCCCAGGACAGAGGGGCACAGGG + Intergenic
1184601045 22:45543557-45543579 CCCCAGGAGGAAGGTGACCTGGG - Intronic
1184938013 22:47739332-47739354 CCCCAGTAGAGACGGCACCTTGG - Intergenic
1185083090 22:48720571-48720593 AGCCAGGACAGAGGGGTCCTGGG + Intronic
1185231481 22:49686639-49686661 CCCAAGGCAGGAGGGGGCCTGGG - Intergenic
1185270224 22:49926565-49926587 GCCCAGGGCAGAGGGGACCGAGG - Intronic
1185281536 22:49971972-49971994 CCCCAGGAGGGAGGAGACCCGGG - Intergenic
1203281595 22_KI270734v1_random:134605-134627 CCCCAGGAAGGAGGGGTCCCTGG - Intergenic
952799989 3:37281429-37281451 CCCAAGAAAAGAGGGGAATTGGG - Intronic
953246829 3:41200145-41200167 CCCCAGGACTGATGGGACTTAGG - Intronic
954418403 3:50405508-50405530 ACCGAGGAATGAGGGGGCCTGGG - Intronic
954458158 3:50611209-50611231 CACCAGGACAGAGGGGGCCAGGG + Intronic
954688756 3:52384725-52384747 CCCCAGGAAAGACAGGGACTGGG - Intronic
954845489 3:53552044-53552066 CCAGAGGGAAGAGGGGGCCTGGG - Intronic
957041836 3:75341728-75341750 CCCCAGGAAACAGGGGCGGTGGG - Intergenic
959780911 3:110232372-110232394 ACCCAGGAAAGATGTGGCCTTGG - Intergenic
960310816 3:116114192-116114214 CCTCAGGAAAGAAGGGAGCATGG - Intronic
961046555 3:123712524-123712546 CCCCAGGAAACAGGGGCTGTGGG - Intronic
962757010 3:138472698-138472720 GCCCTGGAGAGTGGGGACCTGGG - Exonic
962905347 3:139796331-139796353 CCCAAGGAAAGAGGGCATTTGGG - Intergenic
963218092 3:142773707-142773729 CCCCAGGAAAGAGGGTGGGTGGG - Intronic
966116546 3:176470049-176470071 CCCCGGGAAAGAGCAGTCCTAGG + Intergenic
966121585 3:176527832-176527854 CCCAAGGGAAAAGGGAACCTTGG - Intergenic
968689408 4:1982925-1982947 CCCCAGGGTTGAGGGGACCAAGG - Exonic
969227774 4:5810374-5810396 CCCCAGGAAAGAGGGGACCTGGG + Exonic
969498772 4:7540745-7540767 AGCCAGGAAATAGGGAACCTGGG - Intronic
970188286 4:13484794-13484816 GACCAGGGAAGAGGGTACCTCGG + Intergenic
970723061 4:19010230-19010252 CCCCAGGAAGGAAGGGAGTTTGG + Intergenic
971456049 4:26845149-26845171 CCCCAGGACATCAGGGACCTTGG - Intergenic
971969634 4:33604812-33604834 GCACAGGAAAGTGGGGCCCTGGG + Intergenic
974691363 4:65301277-65301299 ACCAAGGAAAGAGGCGACATTGG - Intergenic
975040829 4:69743297-69743319 CCTCAGCAAAGAGGGCACCCTGG + Intronic
975728966 4:77319375-77319397 CCCCAGAATAGGAGGGACCTGGG + Intronic
978086349 4:104660102-104660124 CCCCAGGAAATAGGCAACCATGG - Intergenic
980099841 4:128530719-128530741 CCCCATGAAAAAGGGGACAAAGG - Intergenic
980576831 4:134693902-134693924 CCTGAAGAAAGAGGGGGCCTTGG - Intergenic
981744581 4:148040183-148040205 CCCCAGGCAAGTGGGGAACTTGG + Intronic
983900515 4:173128591-173128613 CCCCAGGGAAGCTGGGACCACGG - Intergenic
984612425 4:181856264-181856286 CCCAAGGAAATCTGGGACCTTGG + Intergenic
984752265 4:183289316-183289338 CGCCAGGAAGGAGGGGAAGTGGG + Intronic
984844895 4:184100738-184100760 CCCCAGGTAAGAGGAGTCCCAGG + Intronic
984958507 4:185070456-185070478 CCACAGGAAAGAGGAGAGATGGG + Intergenic
984973457 4:185210029-185210051 CCCCAGGAAGGAGAGGGCCACGG - Intronic
985576516 5:675740-675762 CCCCAGGGATGAGTGGTCCTGGG + Intronic
986097907 5:4578222-4578244 TCTCAGGAAAGAGGCTACCTGGG + Intergenic
990527329 5:56640834-56640856 CACAAGGAAAGAGGGGAGGTGGG + Intergenic
990842147 5:60094162-60094184 ACTCAGGAAAGAGGGAAACTTGG - Intronic
991480712 5:67076309-67076331 ACGCATGAAAGAGAGGACCTTGG - Intronic
992615657 5:78543675-78543697 CCCCAGGATACAGGGGACCAAGG + Intronic
992632405 5:78694710-78694732 CCCCAAGAAAAATGTGACCTTGG - Intronic
992782740 5:80143008-80143030 ACCCAGAAAAGATGAGACCTCGG + Exonic
995855317 5:116585544-116585566 GCCCAGGCAAGAGCGGGCCTGGG - Intergenic
996294089 5:121890832-121890854 TCTCAGTAGAGAGGGGACCTGGG + Intergenic
997095551 5:130906627-130906649 CACAAGAAAAGAAGGGACCTCGG + Intergenic
997832010 5:137158233-137158255 CCCCAGGGCAGAGGGGACACTGG + Intronic
998228216 5:140342988-140343010 CCACCAGAAAGAGGGAACCTCGG + Intronic
998328885 5:141305929-141305951 CCCCAGGAAAGTGAGGAGCGTGG - Intergenic
999693421 5:154168122-154168144 CCCGGGGAAACAGGGTACCTGGG + Intronic
1001044523 5:168361639-168361661 CCCAAGGACCCAGGGGACCTGGG - Intronic
1002135312 5:177104053-177104075 CCCCAGGAAGGAGTGGCCCATGG - Intergenic
1002172668 5:177384175-177384197 GGCCAGGAACGAGGGGACCCTGG + Intronic
1002778220 6:346830-346852 TGCCAGGACAGAGGGGACCCAGG + Intronic
1003124895 6:3348321-3348343 CTCCAGGAAAGATGGCGCCTAGG - Intronic
1003954148 6:11146572-11146594 CCACAGGATACAGGGGACCAGGG - Intergenic
1004814063 6:19293506-19293528 ACTCAGGACAAAGGGGACCTTGG + Intergenic
1007630063 6:43268502-43268524 CTCCAGGAAGGAGGGGGCCTGGG - Intronic
1008495050 6:52124673-52124695 CCACAGGAAAGAAGGGATGTGGG + Intergenic
1008520191 6:52355757-52355779 CCTCAGGATAGATGAGACCTGGG - Intergenic
1010571522 6:77478604-77478626 TCTCAGCAAAGAGGGGACATGGG - Intergenic
1011718389 6:90130297-90130319 GCCCAGGATACAGGTGACCTAGG + Intronic
1011807423 6:91087976-91087998 CCCAAGGACAAAGGGGACTTTGG - Intergenic
1013592597 6:111631985-111632007 TCCCAGGAAAGAGTGGATGTTGG + Intergenic
1014941300 6:127442345-127442367 CACCAGGAAAGAGGAACCCTGGG - Exonic
1017399668 6:154045854-154045876 CCTCAGGAGAGAGGGGAGCAAGG - Intronic
1018065861 6:160124804-160124826 GGCCTGGTAAGAGGGGACCTTGG + Intronic
1018169666 6:161134766-161134788 CCTTAGGCAAGAGGGGTCCTTGG - Exonic
1018603936 6:165577615-165577637 CTCCAAGAGTGAGGGGACCTGGG - Intronic
1019172106 6:170138364-170138386 CCCCAGGATCGGGGGGGCCTTGG + Intergenic
1019277555 7:183872-183894 CCCCAGGACAGAGGGGCCCGGGG - Intergenic
1019432522 7:1005832-1005854 CCACAGGAGAGAGAGGAACTGGG - Intronic
1021695227 7:23269738-23269760 CCTCAGGAAAGTGAGGCCCTGGG - Intronic
1022014250 7:26335451-26335473 CCACAGGCTAGAGGGTACCTAGG - Intronic
1022258930 7:28685482-28685504 CTCCAGGAAAAAAGGGCCCTGGG + Intronic
1022393436 7:29963247-29963269 GCCCAGGAGAGAGGGGTCCTAGG - Intronic
1023085747 7:36568621-36568643 CCCCAGAAGAGAGGGGAACTGGG - Intronic
1024579647 7:50791955-50791977 CTCCTGGAAAGAGAGGAACTCGG + Intronic
1024608949 7:51046456-51046478 GCCCAGGACAGAGCAGACCTCGG - Intronic
1026593625 7:71716263-71716285 CCCCACGGCAGAGGGGACCATGG - Intergenic
1029160011 7:98544743-98544765 TCCCAGGGAAGAGGGGGACTCGG + Intergenic
1029620040 7:101684671-101684693 CCCCAGGAATGATGACACCTGGG + Intergenic
1029958167 7:104661305-104661327 CTCCAAGAAAGAGGGCACATGGG - Intronic
1030079753 7:105767246-105767268 CCCCAGGAAAGCTGGAATCTTGG - Intronic
1030110782 7:106024715-106024737 CACCAGGACCGAGGGGAGCTGGG - Intronic
1032709248 7:134448031-134448053 CTCCAGGAGAGAAGGGTCCTCGG + Exonic
1034268869 7:149793759-149793781 CCAAGGGAAGGAGGGGACCTCGG + Intergenic
1034498177 7:151434088-151434110 CCTCCGGATCGAGGGGACCTGGG + Intronic
1034938640 7:155215897-155215919 CCCCTGTAAAGCCGGGACCTTGG + Intergenic
1034961151 7:155365377-155365399 GCCCAGGAAAGAGGGTAAGTGGG + Intronic
1034994317 7:155568720-155568742 CCCCGGGAAAGAGGGGGCAGTGG - Intergenic
1035070778 7:156143696-156143718 CCCCAGGGAGCAGGGGTCCTGGG + Intergenic
1035171869 7:157021562-157021584 CCCGAGGGAAGAGGGCAGCTGGG + Intergenic
1035209066 7:157314341-157314363 GGCCTGGAAAGAGGGGACATGGG - Intergenic
1035283515 7:157792374-157792396 CCACAGCAAAGAGGGGACCCAGG - Intronic
1035624260 8:1059695-1059717 CCACAGCAAAGAGGGCGCCTTGG - Intergenic
1037881447 8:22575295-22575317 CCCCTGGGAAGAGGAGGCCTTGG - Exonic
1039059727 8:33564154-33564176 CCCCAGGAAAGAGGGGCTCCAGG + Intronic
1039379808 8:37074572-37074594 TCCCTGGGAAGAGGGGAGCTGGG - Intergenic
1040416934 8:47203474-47203496 GCCCAGGGCTGAGGGGACCTAGG + Intergenic
1041271282 8:56111697-56111719 CCCTAGGAAAAAGGGGACTGGGG - Intergenic
1045057646 8:98382967-98382989 CCAGAGTAAGGAGGGGACCTTGG - Intergenic
1045439266 8:102193611-102193633 CCCTAGGAAAGAAGGGTGCTGGG + Intergenic
1046981867 8:120345311-120345333 CACAAGGAAAGAGAGGACCAGGG - Intronic
1048544264 8:135371617-135371639 AGTCAGGAAAGAGGAGACCTAGG - Intergenic
1049024474 8:139979289-139979311 CCCCAGGAAGGAGGGGTCCTGGG + Intronic
1049102738 8:140590842-140590864 CCCCAGGGCAAAGGGGCCCTAGG - Intronic
1049127352 8:140804036-140804058 CCCAAAGAAAGAGGGGATCTGGG + Intronic
1049324888 8:142016726-142016748 CCCCAGGGATGAGGGGACGTTGG + Intergenic
1049542793 8:143215997-143216019 CCCCAGGAAAGACGGGCCTGGGG + Intergenic
1049663872 8:143834353-143834375 CAGCAAGAAAGTGGGGACCTTGG + Exonic
1050332402 9:4558493-4558515 CTCCAGGACAGAGGGGAAATTGG + Intronic
1050622924 9:7473576-7473598 ACTCAGGAAAGAAGGGACCAGGG - Intergenic
1051502898 9:17797322-17797344 CCCCAGGAAGGAGGAGAATTTGG + Intergenic
1052295755 9:26894727-26894749 CCAGATGAAAGAGGGAACCTTGG - Intergenic
1056580814 9:87887153-87887175 TCCCAGGAAAATGGGAACCTTGG - Exonic
1056600335 9:88042173-88042195 CCCCTGAAAAGAGGATACCTAGG + Intergenic
1057039400 9:91836600-91836622 CCAGAGGACAGAGGAGACCTGGG - Intronic
1057211980 9:93205438-93205460 CCCCAGGAACAAGGGGGCCCAGG - Intronic
1057272189 9:93657592-93657614 CCCCAGGACTGAGAGGACCCAGG + Intronic
1057797560 9:98169552-98169574 CCTGAGGACAGAGGGGACCCGGG - Intronic
1059354954 9:113691594-113691616 CACCAGGAATCAGGAGACCTGGG - Intergenic
1059390844 9:113998806-113998828 CCCCAGCAAAAAGAGGACCATGG - Intronic
1060973594 9:127752770-127752792 CCCCAGGGCAGAGGCCACCTTGG - Intronic
1061324168 9:129852673-129852695 CCCCAGGAAAGAGGCAGCCCTGG - Intronic
1061326866 9:129869433-129869455 CCCCAGGGATGGGGGGAGCTGGG + Intronic
1061504026 9:131020493-131020515 CCCCAGGTTAGAGGAGAACTTGG - Intronic
1061985822 9:134129633-134129655 CCTAAGGAAAGAGGTGACGTGGG - Intergenic
1062521251 9:136958915-136958937 CCCCAGGAAAGATGGGATGAGGG - Intergenic
1062645190 9:137544193-137544215 CCCCAGGTCAGAGGGGAAGTTGG - Intronic
1185505160 X:627816-627838 CCCCAGGAAAGCCTGGTCCTTGG + Intronic
1187189992 X:17025180-17025202 ATCCAGGTAAGAGGCGACCTGGG + Exonic
1189286193 X:39854105-39854127 CCCCAGGAACCAGGGTTCCTTGG - Intergenic
1189545921 X:42042593-42042615 CCCCAGGCAGGAAGGGACATTGG + Intergenic
1189700778 X:43715155-43715177 CCACAGGGAAGAGGGTACATAGG + Intronic
1190248367 X:48705429-48705451 CCTCAGGGAAGAGGGGCCATGGG + Intronic
1199025235 X:142928595-142928617 CTCCAGTAAAGAGGAGAACTGGG - Intergenic
1199339284 X:146657788-146657810 GCCCATCAAAGAGGGAACCTAGG + Intergenic
1199745524 X:150769908-150769930 CCACAGGCAAGAGGGAACTTGGG - Intronic
1200179247 X:154140484-154140506 CCCAAGGAAAGAGGGCCCCTGGG - Intergenic