ID: 969229042

View in Genome Browser
Species Human (GRCh38)
Location 4:5816937-5816959
Sequence TGGACAGGAGTCAGTTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969229042_969229044 -6 Left 969229042 4:5816937-5816959 CCTAGAGAACTGACTCCTGTCCA 0: 1
1: 0
2: 1
3: 10
4: 186
Right 969229044 4:5816954-5816976 TGTCCATGTTCTCCTTTCTCTGG 0: 1
1: 0
2: 3
3: 29
4: 289
969229042_969229049 26 Left 969229042 4:5816937-5816959 CCTAGAGAACTGACTCCTGTCCA 0: 1
1: 0
2: 1
3: 10
4: 186
Right 969229049 4:5816986-5817008 AGCTGCCTCCGTCATGCTCTGGG 0: 1
1: 0
2: 1
3: 8
4: 147
969229042_969229048 25 Left 969229042 4:5816937-5816959 CCTAGAGAACTGACTCCTGTCCA 0: 1
1: 0
2: 1
3: 10
4: 186
Right 969229048 4:5816985-5817007 TAGCTGCCTCCGTCATGCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969229042 Original CRISPR TGGACAGGAGTCAGTTCTCT AGG (reversed) Intronic
902670058 1:17966944-17966966 TGCCAAGGAGTCAGTTTTCTTGG - Intergenic
906726615 1:48048953-48048975 TGGAGAGGAGTGAGTGCTCGAGG + Intergenic
911135710 1:94437768-94437790 TGGAAAGGATTCAGTACTCTAGG + Intronic
917926264 1:179791437-179791459 TGGCCAGGAGGCAGTTCTTTGGG + Intronic
918971602 1:191426991-191427013 TGGGCTGGAGTGACTTCTCTAGG - Intergenic
919756298 1:201068127-201068149 AGGGCAGCAGTCACTTCTCTGGG + Intronic
920219029 1:204382466-204382488 TGGAGAGTTGTCAGATCTCTGGG - Intergenic
921760196 1:218904490-218904512 TGGACAGGACTCCTTTCTCAGGG - Intergenic
922743762 1:228031435-228031457 TGCACAGGAGTCAGGTCCCAGGG + Intronic
923045360 1:230351570-230351592 TGGACAGAAGTCACATCCCTAGG - Intronic
1064871758 10:19945500-19945522 TGGCCTGAATTCAGTTCTCTTGG + Intronic
1066521776 10:36228287-36228309 GAGACAGAAGTCAGTCCTCTGGG - Intergenic
1066577088 10:36838090-36838112 TGTAGATGAGTCAGTTGTCTAGG + Intergenic
1067182601 10:44000300-44000322 TGAAGAGGAGACAGTGCTCTGGG - Intergenic
1068242113 10:54316434-54316456 TGGAAAGCAATCAGCTCTCTGGG - Intronic
1069557027 10:69405155-69405177 TGGAAGGGAGTCAGTTTCCTGGG - Intronic
1069921463 10:71818177-71818199 TGGGCAGGGGCCAGTTCTCAGGG + Intronic
1074507822 10:114086937-114086959 TGTAAAGGAGTCACTTATCTGGG - Intergenic
1074830314 10:117243408-117243430 TTGAGAGGAGACAGTTCTCAGGG + Intronic
1074970057 10:118528706-118528728 TGGAATTGAGTCAGTACTCTTGG - Intergenic
1075667068 10:124239287-124239309 TCAACAGGAGTCTGTTCCCTTGG + Intergenic
1075741420 10:124698656-124698678 TGGTGAGGAGTCAGTTTTCCAGG - Intronic
1078457405 11:11485953-11485975 TGCACATGAGTGAATTCTCTTGG + Intronic
1078581717 11:12544096-12544118 TGGACAGGAGCCATGTCTTTAGG + Intergenic
1078771383 11:14355797-14355819 TAAGCAGAAGTCAGTTCTCTTGG - Intronic
1079001226 11:16758531-16758553 TGGACAAGATTCTGTGCTCTAGG + Intergenic
1080295711 11:30724750-30724772 TGGACAGGCCTCAATTCTCATGG + Intergenic
1087143716 11:94791372-94791394 AGTAAAGGAGTCAGCTCTCTGGG - Intronic
1088366134 11:109041728-109041750 TGGAAAGGAGCCAGTAATCTAGG + Intergenic
1088682629 11:112257027-112257049 TGGACAGGAGTGTGTTCTGATGG - Intronic
1088711888 11:112515943-112515965 AGGACAGGTCTCAGTTCCCTTGG + Intergenic
1089448483 11:118572722-118572744 TGGACTGGAGTCAGCTCCATCGG - Intronic
1089572537 11:119419979-119420001 GGGACAGCAGGCAGTTCCCTTGG - Intronic
1089794500 11:120969416-120969438 GGGGCAGGAGTCAGTGCTGTGGG + Intronic
1090958493 11:131535125-131535147 GGGACAGGTGTTAGCTCTCTGGG + Intronic
1091150689 11:133325925-133325947 TGGACAAGAGTTTGTTCTTTAGG - Intronic
1092157099 12:6290463-6290485 TGGACTGGATTCTGTTCTGTCGG + Intergenic
1092157183 12:6290927-6290949 TGGACTGGATTCTGTTCTGTCGG + Intergenic
1092157216 12:6291117-6291139 TGGACTGGATTCTGTTCTGTCGG + Intergenic
1092157258 12:6291363-6291385 TGGACTGGATTCTGTTCTGTCGG + Intergenic
1092157299 12:6291610-6291632 TGGACTGGATTCTGTTCTGTCGG + Intergenic
1092315111 12:7403604-7403626 TGGGAATGAGTCAGCTCTCTGGG - Exonic
1092317495 12:7433443-7433465 TGGAAATGAGTCAGCTCTCTGGG - Exonic
1092683638 12:11016671-11016693 TGGACATGAGTCAAAACTCTAGG - Intronic
1095130703 12:38539014-38539036 TTGCCAGGAGTCACTTGTCTAGG - Intergenic
1096777392 12:53972694-53972716 GGGAAAGGATTCACTTCTCTGGG + Intergenic
1102588103 12:113937276-113937298 TAGACAGCAGTCAGGGCTCTGGG - Intronic
1104369950 12:128215700-128215722 TGGCTAGGAGTGAGGTCTCTGGG + Intergenic
1105541481 13:21320579-21320601 TGGACATTAAACAGTTCTCTAGG + Intergenic
1106185151 13:27403373-27403395 TGCACAGCAGCCAGATCTCTGGG + Intergenic
1106476240 13:30100544-30100566 TGGAAAGGACTCAGTGCTGTGGG + Intergenic
1110474092 13:75892915-75892937 TGGACAGTCATCATTTCTCTAGG - Intergenic
1115335945 14:32244450-32244472 TGGAGAGGGGGCAGTTCACTGGG + Intergenic
1117323200 14:54643863-54643885 TGGAAAGGCGTCTGTTCTCCAGG - Intronic
1118679335 14:68223452-68223474 TGGACAGGACTCAGTGAACTTGG - Intronic
1120644104 14:87051542-87051564 TAGACAGGACTCAGTTCTCAAGG + Intergenic
1122830442 14:104393176-104393198 TTGACATGACTCAGGTCTCTGGG - Intergenic
1122850374 14:104524956-104524978 TGGACAGGTTTCGTTTCTCTTGG - Intronic
1123120329 14:105913466-105913488 TGTGCAGGAGTCAGTCCTCCTGG + Intergenic
1202854272 14_GL000225v1_random:40804-40826 TAGACAGGAGTCACATCTCCTGG + Intergenic
1202857668 14_GL000225v1_random:61225-61247 TAGACAAGAGTCACATCTCTTGG - Intergenic
1125793073 15:42384520-42384542 TTGACAGATGTCAGTTCTGTTGG - Exonic
1126062145 15:44792978-44793000 TGGACATGGGTCATTTCTCACGG - Intergenic
1126694111 15:51311769-51311791 TGAATAGGAGTCAGACCTCTGGG + Intronic
1128091972 15:64925449-64925471 TGGACAGGAAGAAGGTCTCTGGG - Intronic
1128578756 15:68794009-68794031 TGAACTTGAGCCAGTTCTCTCGG - Intronic
1128778129 15:70339524-70339546 TGGTCAGGAGTCTGACCTCTGGG - Intergenic
1130229238 15:82083887-82083909 TGGAGAGGAGTCAATATTCTTGG + Intergenic
1132308020 15:100831724-100831746 TCCCCAGGAGTCAGTCCTCTGGG - Intergenic
1133080100 16:3311770-3311792 GGGAAAGGAGGCAGTGCTCTTGG + Exonic
1135669148 16:24360343-24360365 TGGAGAGGAATCAGTTTCCTAGG - Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1137366464 16:47863751-47863773 TGGACAGGTTTCATTTTTCTTGG + Intergenic
1139809370 16:69600128-69600150 AAGACAGGATTCATTTCTCTGGG + Intronic
1141638494 16:85328293-85328315 TGGCCAGGAGACTCTTCTCTGGG - Intergenic
1141683627 16:85557669-85557691 TGGACAGGACCCAGCTCCCTTGG + Intergenic
1142481276 17:219668-219690 TGGATGGGAGTCTGTCCTCTAGG + Exonic
1145182111 17:20762260-20762282 TTGAGAGGAGTCAGTTACCTTGG + Intergenic
1146553425 17:33802004-33802026 TGGACAGCTGTTAGTTCCCTGGG + Intronic
1148395067 17:47301400-47301422 TAGAAAAGAGTCAGCTCTCTGGG + Intronic
1149313893 17:55421528-55421550 TGGCCAGGGATCAGTTCCCTGGG - Intronic
1155695865 18:28685824-28685846 TTGCCATTAGTCAGTTCTCTTGG - Intergenic
1158953189 18:62516149-62516171 TGGAGAAGAGTTAGTTCTTTGGG - Intergenic
1162976940 19:14212004-14212026 TGGAGAGGAGGCAGTTTTGTAGG + Intergenic
1168171898 19:54594995-54595017 AGGAAGGGAGTCAGTTCTCAGGG + Intronic
925230654 2:2230907-2230929 TGGACAGGAGTCAGGTTCCATGG + Intronic
926027926 2:9560837-9560859 TGGCCAGAAGTCATTACTCTTGG + Intergenic
930206449 2:48591772-48591794 AGGACAGAGGTCAGGTCTCTGGG + Exonic
931067081 2:58599154-58599176 GGGAAGGGAGTCAGTTCTCTGGG - Intergenic
932429292 2:71664376-71664398 TGGACAGCAGCCTGTTCTCCAGG - Exonic
935812210 2:106809440-106809462 AGGACTGGAGTCAGTTGTGTTGG + Intronic
936062134 2:109301863-109301885 TGGAGAGAAGTCTGTTCTCAAGG + Intronic
937468474 2:122155314-122155336 TGGACAGGGGCCACTGCTCTGGG + Intergenic
938763279 2:134443939-134443961 CAGGCAGGAGTCAGTGCTCTTGG + Intronic
942182953 2:173397687-173397709 TGGGAAGGACTCTGTTCTCTGGG - Intergenic
942436635 2:175984869-175984891 TGAACATAAGTCATTTCTCTGGG - Intronic
944512765 2:200480821-200480843 AGAATAGGACTCAGTTCTCTAGG - Exonic
946296184 2:218785424-218785446 TTAACAGGAGTCTGTTTTCTTGG - Intronic
948087943 2:235266561-235266583 TGGAGAAGAGGCAGTTCCCTGGG - Intergenic
1169745160 20:8935845-8935867 TGGAGAGGAGACAGTCCTCAGGG - Intronic
1172967637 20:38849327-38849349 TGGATAGGACTCAGATCTCCAGG - Intronic
1173549700 20:43924027-43924049 TGAACAGCAGGCAGTTCCCTTGG + Intronic
1175817453 20:61890882-61890904 TGGACAAGACTCAGTCCTCATGG + Intronic
1183649399 22:39145499-39145521 TGGAAAGGAGCCAGGGCTCTGGG + Intronic
1184179600 22:42811478-42811500 TTGTATGGAGTCAGTTCTCTAGG - Intronic
950096266 3:10332593-10332615 TGAAAAGGAGTCAGTCCTCCAGG - Intronic
950185457 3:10942548-10942570 TGGACAGGAGTAAGTTCACAGGG + Intergenic
950801566 3:15555884-15555906 TAGTCAGTAGTCAGTTTTCTTGG + Intergenic
951195390 3:19817971-19817993 TGGACATGAGACAATTCTTTGGG - Intergenic
952525906 3:34210476-34210498 TGGACATGGGTCATTTCTCACGG + Intergenic
952990314 3:38826021-38826043 TGGTTAGGAGTCTGTTCTCTTGG + Intergenic
954235926 3:49257120-49257142 TGGAAAGTAGCCAGTTGTCTTGG - Exonic
955479691 3:59376985-59377007 TGGACAAGATTCAATTCTCATGG + Intergenic
960422123 3:117459772-117459794 TTGACAGGAGTTAGAACTCTTGG - Intergenic
964240430 3:154586462-154586484 TGGCCAGAAGTTAATTCTCTAGG + Intergenic
969229042 4:5816937-5816959 TGGACAGGAGTCAGTTCTCTAGG - Intronic
970918217 4:21361179-21361201 AGCACTGGAGTCAGTTGTCTTGG + Intronic
978320817 4:107493422-107493444 TGGTTAGGAGTCAGTATTCTTGG - Intergenic
978888171 4:113790860-113790882 TGAAAAGGAGACAGTTCTCAGGG + Intergenic
979278574 4:118839569-118839591 TGGACATAAATAAGTTCTCTTGG + Intergenic
981274047 4:142876851-142876873 TGAACATGAGTTAGGTCTCTTGG - Intergenic
981716160 4:147754433-147754455 TAGAAAGGAGTCAGTGTTCTGGG + Intronic
983783186 4:171698679-171698701 TGGACAGGACTTAGTTCACAAGG - Intergenic
984111704 4:175625044-175625066 TGGAGAGGAATCAGATTTCTGGG - Intergenic
984663699 4:182402461-182402483 TGTACAGTAGTCAGTTTTCTGGG + Intronic
986045125 5:4029259-4029281 TGCACAGGAGTCAGTGGACTGGG + Intergenic
986419626 5:7565836-7565858 TGCTCAGGACTCAGTGCTCTGGG - Intronic
987710405 5:21496420-21496442 TGGAGAGGAGTCAGTTCCAGTGG + Intergenic
988997819 5:36731089-36731111 TGGAAAGATGTCAGTTCTGTGGG + Intergenic
989590411 5:43107698-43107720 TGGCCAGGACTCTGTTCGCTTGG + Intronic
989745864 5:44828834-44828856 TGGACAGGACTCAGAACACTTGG - Intergenic
990755008 5:59058732-59058754 TAGACAGGTGTCTGTTCTGTTGG - Intronic
991737460 5:69640946-69640968 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
991760733 5:69915479-69915501 TGGAGAGGAGTCAGTTCCAGTGG + Intergenic
991786598 5:70202622-70202644 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
991789036 5:70220672-70220694 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
991813786 5:70495778-70495800 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
991816916 5:70517062-70517084 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
991839963 5:70790530-70790552 TGGAGAGGAGTCAGTTCCAGTGG + Intergenic
991879042 5:71203007-71203029 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
991881482 5:71221036-71221058 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
992213413 5:74503167-74503189 TGTAAAGGAGTAAGTCCTCTGGG - Intergenic
994422355 5:99536527-99536549 TGGAGAGGAGTCAGTTCCAGTGG + Intergenic
994460019 5:100061013-100061035 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
995486377 5:112644189-112644211 TGGACATGAGACAGGTTTCTGGG + Intergenic
996474388 5:123899873-123899895 TGGACAAGAGAAAGTTCTTTTGG + Intergenic
998251693 5:140557684-140557706 TGTCCAGGAGCCAGTGCTCTAGG + Exonic
999631819 5:153579173-153579195 TGGAAAGGAGTCAGAGCTTTGGG - Intronic
1000396652 5:160782236-160782258 TGGGCAGGAGCCAGTTCTGGTGG - Intronic
1000796544 5:165671490-165671512 AGGACAAGGGTCAGATCTCTGGG + Intergenic
1001248831 5:170129121-170129143 TGGACATGCTTCATTTCTCTTGG - Intergenic
1001249200 5:170133171-170133193 TGGACAGGACTCTGGTCTCACGG - Intergenic
1002061513 5:176628538-176628560 TGGGCAGGAGACAGTTCACGAGG - Intronic
1003432900 6:6056389-6056411 TGGACAGGAGTGAGCTCCGTGGG + Intergenic
1003893746 6:10586970-10586992 TTCAAATGAGTCAGTTCTCTAGG - Intronic
1005547289 6:26884097-26884119 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
1006639391 6:35481505-35481527 TGGACAGGAGTCTGATTCCTGGG - Intronic
1008499116 6:52162704-52162726 GGCACAGGAATCAGATCTCTTGG + Intergenic
1009018048 6:57925170-57925192 TGGAGAGGAGTCAGTTCCAGTGG - Intergenic
1009354231 6:62721302-62721324 TGGACATCAGTCAATACTCTTGG + Intergenic
1014565926 6:122947413-122947435 AAGACAGAAGTCAGTCCTCTGGG - Intergenic
1014957652 6:127640800-127640822 TGGGCAGAAATCACTTCTCTGGG - Intergenic
1015006666 6:128290601-128290623 GGAACAGGGGCCAGTTCTCTAGG + Intronic
1017595714 6:156026689-156026711 TGGAGAAGAGTAATTTCTCTTGG - Intergenic
1017900420 6:158714625-158714647 TGAAAAGGAGTCTGTCCTCTGGG - Intronic
1017957757 6:159193014-159193036 TGGACACGAGGAAGTTGTCTGGG + Intronic
1019120698 6:169801484-169801506 TGGACAGGAGGCAGAGCTCGGGG + Intergenic
1019277188 7:182010-182032 TGGAAAGGAGTGAGTCCTCCAGG + Intergenic
1021795901 7:24254135-24254157 TGGAGCTGAGTCAGCTCTCTGGG - Intergenic
1022519407 7:30996313-30996335 TCGACAGGAGCCATTGCTCTGGG - Intergenic
1024533160 7:50409776-50409798 TGGACAGGAGACAGAGTTCTAGG - Intergenic
1024888865 7:54178881-54178903 TGAACTGGAGTCAGCTCTCTTGG + Intergenic
1025016327 7:55441624-55441646 TGGACATCAGACAGTTTTCTAGG + Intronic
1025927035 7:65968475-65968497 TGGAGAGGAGTCAGTTCCAGTGG - Intronic
1038902960 8:31864647-31864669 TGGTCAGGGGCCAGTTCTGTAGG + Intronic
1038995529 8:32918768-32918790 TGGACAGTATTTAGTTCTGTGGG + Intergenic
1039611428 8:38922387-38922409 TGGTCAGAAGTCAGGTCACTGGG + Intronic
1041823902 8:62069339-62069361 AGGACAGAGGTCAGTCCTCTGGG - Intergenic
1044731322 8:95230878-95230900 TGGACAGGAGTGGTTTGTCTTGG + Intergenic
1045257719 8:100543095-100543117 TGGGCAGGTGTCTGGTCTCTGGG - Intronic
1049148582 8:141019888-141019910 TGAACAGGAGTTTGTGCTCTTGG - Intergenic
1049983537 9:926962-926984 CAGACAGACGTCAGTTCTCTGGG - Intronic
1050122795 9:2325133-2325155 TGGCCAGGGGTCTGTTTTCTAGG + Intergenic
1055819382 9:80243493-80243515 AAGACAGGACTCAGTTCACTAGG + Intergenic
1058381888 9:104385652-104385674 GGGACAGGAGGCAGTTGTCATGG + Intergenic
1059801826 9:117757689-117757711 TGGGCAGGAGTTAGTGCTGTAGG + Intergenic
1060045510 9:120337133-120337155 TGGAGAGGAGTCAGGTCCCTGGG - Intergenic
1186478423 X:9877383-9877405 TGCCCAGGAGTCAGATCTGTCGG + Intronic
1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG + Intergenic
1189024569 X:37379084-37379106 TGGACAGGAGGCAAGTCTTTTGG + Intronic
1189176739 X:38964999-38965021 TGGACACGTTTCATTTCTCTTGG - Intergenic
1191231706 X:58101157-58101179 TGGGCAGGAGTCTCTGCTCTTGG - Intergenic
1191237281 X:58144267-58144289 TGGACAGGAGTCTCTGCCCTTGG - Intergenic
1194989945 X:100536740-100536762 TAGACAGAAGGCAGTCCTCTGGG + Intergenic
1196250412 X:113453455-113453477 TGCAAAAGAGTCAGGTCTCTTGG + Intergenic
1197756450 X:129998680-129998702 CAGTCAGGAGTCTGTTCTCTAGG + Intronic
1198296473 X:135292434-135292456 GGGAAAGGAGGCAGTGCTCTTGG - Exonic
1201923753 Y:19262360-19262382 TGGAGAGGGGGCAGTTCACTGGG + Intergenic