ID: 969233503

View in Genome Browser
Species Human (GRCh38)
Location 4:5848819-5848841
Sequence CTTTATAAGGAGAAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 9, 2: 14, 3: 72, 4: 471}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969233503_969233505 -3 Left 969233503 4:5848819-5848841 CCTCTCTTCTTCTCCTTATAAAG 0: 1
1: 9
2: 14
3: 72
4: 471
Right 969233505 4:5848839-5848861 AAGCCACTAATCCCGTCATAAGG 0: 1
1: 0
2: 14
3: 111
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969233503 Original CRISPR CTTTATAAGGAGAAGAAGAG AGG (reversed) Intronic
900775856 1:4585113-4585135 CATTTTAGGGAGAAGAAGGGGGG + Intergenic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
901692787 1:10984459-10984481 CTTTATAAGAAGAGGAAAATTGG - Intergenic
902539134 1:17140164-17140186 CTTTATAAGAAAAGCAAGAGAGG - Intergenic
903642573 1:24870041-24870063 CTTTGTAATTACAAGAAGAGAGG - Intergenic
904292308 1:29495926-29495948 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
904797426 1:33067544-33067566 GTTTGTAAGGAGAAAAAGAGAGG - Intronic
905847697 1:41246499-41246521 CTTTATAAGGAGCAGCTGAAAGG + Intergenic
907475945 1:54705591-54705613 ATTTATGAGGTGAAGAAGAGTGG + Intronic
907682800 1:56579585-56579607 CTTTAAAAAGAGAAGACGTGGGG + Intronic
908890678 1:68844108-68844130 CTTTATAAGGAGAGGAAATTAGG + Intergenic
910219744 1:84878406-84878428 ATTTAAAGGGAAAAGAAGAGAGG - Intronic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
911346458 1:96702316-96702338 GTTAATATGGACAAGAAGAGAGG + Intergenic
911490323 1:98557262-98557284 TTTTATAAGGAAAAGAGTAGGGG + Intergenic
911845330 1:102745646-102745668 CATCAAAAGGAGAAGGAGAGGGG - Intergenic
912056007 1:105598430-105598452 CTTTATTAGCAGCATAAGAGTGG + Intergenic
912442126 1:109707161-109707183 GTTTGTAAGGAGAAAAAGAAAGG - Intronic
914516165 1:148376572-148376594 ATTTATAAAGAGAAGAGGAAAGG + Intergenic
915196278 1:154192363-154192385 TTTTAAAAGAAGAGGAAGAGGGG + Intronic
916323195 1:163529092-163529114 CTTAATAAGAAGATGAAGAGAGG + Intergenic
916461040 1:165024687-165024709 CTCTATATCGAGAAGTAGAGAGG - Intergenic
917313572 1:173702453-173702475 GTTTATAAGGAGAAGAAAAGAGG + Intergenic
917509464 1:175658273-175658295 CTTTATGGGGAGAAGAAATGAGG + Intronic
918277399 1:182966770-182966792 CTTTAGAAGGACAAGATGGGCGG - Intergenic
918422524 1:184378553-184378575 CTTTAACAAGAGATGAAGAGGGG + Intergenic
918432139 1:184472233-184472255 CTTTTTAATCAGAAGAAGAAAGG + Intronic
918934296 1:190900091-190900113 TTTCATAAGGAGAAGAACAAGGG + Intergenic
919010593 1:191956846-191956868 CTTTAAAAGGAGGAGGAAAGAGG + Intergenic
919529478 1:198699215-198699237 CTTTGTAGGGAGAATAAGAAAGG - Intronic
921125098 1:212170512-212170534 CTTTATAAGAAGAGGAAAAGGGG + Intergenic
922666068 1:227470653-227470675 CATTTAAAAGAGAAGAAGAGTGG + Intergenic
922786365 1:228284355-228284377 CTTTAAAAGAAGATGAAGAGAGG - Intronic
923286249 1:232498727-232498749 CCTTATAAGGAGGAAAACAGAGG - Intronic
923774920 1:236969597-236969619 TTTTATAAGAACAGGAAGAGAGG + Intergenic
924046598 1:240038294-240038316 CTTTTTAAGTAAAAGAAAAGGGG - Intronic
924271716 1:242340547-242340569 CTTAATAAGAAGAATAATAGTGG + Intronic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064716615 10:18183007-18183029 TTTAATTAGGAGAAGCAGAGGGG + Intronic
1064820237 10:19321189-19321211 TTTTATCATGAGAAGAACAGAGG - Intronic
1066243142 10:33557089-33557111 GTTTATAAGGTGAAGAATGGAGG + Intergenic
1066342331 10:34547998-34548020 CTTGATCAGTAGAAGATGAGTGG - Intronic
1067150213 10:43726257-43726279 TTTTATAAAGAGGAGGAGAGGGG - Intergenic
1068066697 10:52140837-52140859 CTATATAAGAAGAAGAATACAGG - Intronic
1068383717 10:56295349-56295371 CCTTATAAGGGGAAAATGAGAGG - Intergenic
1068659716 10:59611623-59611645 CTTTATGAGGCGAAGAGCAGAGG + Intergenic
1068803341 10:61166378-61166400 ATCTTTAAGGAGGAGAAGAGAGG + Intergenic
1069093768 10:64233114-64233136 TTTTCAAAAGAGAAGAAGAGAGG + Intergenic
1069162580 10:65109425-65109447 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
1069177458 10:65311015-65311037 CTTTAAAAGGACAAGCAGATTGG + Intergenic
1069328754 10:67264685-67264707 ATCTATAATGAGAAGAAGAGAGG - Intronic
1070983077 10:80665888-80665910 CTGTATGAGGAAAAGAAGATGGG - Intergenic
1071224166 10:83508714-83508736 CTCTCTAAAAAGAAGAAGAGTGG + Intergenic
1071436645 10:85653742-85653764 TTTTATAAGGAGAAGAAGAGAGG + Intronic
1072398470 10:95070535-95070557 GTTTATAAGGATAAGAGGACCGG + Intergenic
1072454929 10:95567477-95567499 CTTTAAAAAAAGAAGAAAAGAGG + Intergenic
1072641877 10:97217297-97217319 CATTATATGGAGAAGTAGAGTGG + Intronic
1072652038 10:97303393-97303415 CTTTACAAGAAGAGGAAGAGAGG + Intergenic
1073464198 10:103684320-103684342 CTATAAAAGGAGGAGAATAGAGG + Intronic
1073522523 10:104146967-104146989 CTTTATAGTGCAAAGAAGAGAGG - Intronic
1073642939 10:105271277-105271299 CTTTATAAGAAGAAGAAACTAGG + Intergenic
1074089944 10:110241314-110241336 TTTTATTGGGAGAAGAAAAGTGG + Intronic
1075523367 10:123159668-123159690 CATTATAAGGGGAAAAATAGGGG + Intronic
1076107041 10:127831913-127831935 CTTTATAAGAAGAAGAAATTAGG + Intergenic
1078353144 11:10611940-10611962 CTTACTGATGAGAAGAAGAGAGG + Intronic
1078437257 11:11335711-11335733 CTTTATAAGAGGAAAAAGAATGG + Intronic
1078734623 11:14008632-14008654 TTTTAGTAGGAGAAGAAGTGAGG - Intronic
1080861501 11:36154111-36154133 CTTTACAAAAAGAAGAACAGAGG - Intronic
1080883334 11:36342769-36342791 ATTTAAAGGGAGAAGAAGACTGG - Intronic
1082309781 11:50632513-50632535 GTTTTTAAGGAGAAAAAGAAAGG + Intergenic
1082702168 11:56445430-56445452 CTTTCTAAGGAAAACAAGGGAGG + Intergenic
1084223931 11:67703134-67703156 GTTTGTAAGGAGAAAAAGAAAGG - Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1085206765 11:74738657-74738679 CATTATAACAAGAAGCAGAGTGG - Intergenic
1085380859 11:76116568-76116590 CTTTGAAAAGAGAAGGAGAGAGG + Intronic
1086079517 11:82888947-82888969 CTTTAAATGTAGAATAAGAGAGG + Intronic
1087371970 11:97295463-97295485 CTTTATAAGGTTAAGAACATAGG + Intergenic
1087608563 11:100406722-100406744 CCTTATAAGAAGAAGAAATGTGG + Intergenic
1088747388 11:112815600-112815622 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1088928103 11:114322567-114322589 CTTTATAATCATTAGAAGAGTGG + Intergenic
1089073094 11:115716366-115716388 CTTTCTAAGGGGAAGGAGAGAGG + Intergenic
1089312690 11:117570336-117570358 CTGTCTAAGGAGAAGCAGAACGG - Intronic
1089553764 11:119302910-119302932 CTGTATAAGAAGAGAAAGAGAGG - Exonic
1089757038 11:120694835-120694857 CTTTATAAAAAGAAGAAGACAGG + Intronic
1090352693 11:126117197-126117219 CTTTATAGAGAGAAGAAATGAGG - Intergenic
1090721762 11:129481801-129481823 ATTTACAAAGAGAAGAACAGGGG + Intergenic
1091326247 11:134690321-134690343 CTGTGTAAGGCCAAGAAGAGCGG + Intergenic
1092159223 12:6306847-6306869 CTTAGTAGGGAGAACAAGAGTGG + Intergenic
1093754253 12:22834514-22834536 GTTTATCAGGAGAAGAACATGGG + Intergenic
1094253239 12:28391054-28391076 CTTTTTAAGGAGAAGATGTGTGG + Intronic
1094336065 12:29355490-29355512 CTCTATATGGAAAAGAAGGGAGG + Intronic
1094574692 12:31674469-31674491 CCTTAAAAGTAGAAGGAGAGAGG - Intronic
1094865697 12:34527928-34527950 GTTTGTAAGGAGAAAAAGAAAGG - Intergenic
1096100136 12:48965860-48965882 GTGTCTAAGGAGCAGAAGAGGGG + Exonic
1098129971 12:67340049-67340071 CTTTATAAGGAAAGGGAGAAAGG + Intergenic
1099533408 12:83816202-83816224 CCTTATAAGAAAAGGAAGAGAGG - Intergenic
1099555384 12:84103274-84103296 ATTTGTAAGGAGAAAAAGAAAGG + Intergenic
1099781544 12:87202147-87202169 CTTTATAAGAAGAATAAGTCAGG + Intergenic
1100048539 12:90414357-90414379 CTTTTTAAGGAAAAAAAGTGGGG + Intergenic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1100589116 12:96008501-96008523 ATTTAAAAGGAAAAGAAGAAAGG + Intronic
1100606310 12:96154681-96154703 CCTTATAAGAAGAAAGAGAGAGG + Intergenic
1100735616 12:97526290-97526312 CATTTTAAGGAAAAGAAGAATGG - Intergenic
1100895715 12:99180186-99180208 GTTTATAAGAAGAAGAAAACTGG - Intronic
1100979252 12:100151975-100151997 CTTTATAATCAGTAGAAGTGTGG - Intergenic
1101457549 12:104851803-104851825 CTTTCTAAAGAAAAGAATAGAGG + Intronic
1101501843 12:105311406-105311428 GTTTGTAAGGAGAAAAAGAAAGG - Intronic
1102847021 12:116195736-116195758 TTTTATAAAGAGTAAAAGAGTGG - Intronic
1102892213 12:116568697-116568719 CTTTATGAGCAGAGGAGGAGAGG + Intergenic
1103131002 12:118468598-118468620 CTTTATGAGAAGAGGAGGAGAGG - Intergenic
1103157694 12:118700556-118700578 CTTTTCAAGCAGAAAAAGAGAGG - Intergenic
1103887055 12:124210398-124210420 CTTAAGATGGAGAAGAGGAGAGG - Intronic
1104477894 12:129085216-129085238 CAGTAGAAGGGGAAGAAGAGGGG - Intronic
1106434103 13:29708559-29708581 CCATTTAGGGAGAAGAAGAGAGG - Intergenic
1106927113 13:34624366-34624388 CACTAAAAGGAGAAGAAGACGGG + Intergenic
1107230373 13:38102597-38102619 ATTTTGATGGAGAAGAAGAGAGG - Intergenic
1107692060 13:42963110-42963132 CTGGATGAGGAAAAGAAGAGTGG + Intronic
1109638578 13:65155808-65155830 CTTTAGAAGGCCAAGAAAAGTGG + Intergenic
1110270159 13:73580231-73580253 CCTTAAGAGGAGCAGAAGAGAGG + Intergenic
1110438320 13:75499640-75499662 CATTATATTGAGTAGAAGAGGGG + Intergenic
1111141074 13:84118846-84118868 ACTTCTAAGGAGAAAAAGAGTGG + Intergenic
1111259057 13:85711051-85711073 ATTGATAAGGAGAAGAAGTTTGG - Intergenic
1111794143 13:92896163-92896185 CTTTTTAAGAAGAGGAAGAGAGG - Intergenic
1111826037 13:93268964-93268986 CTTTAAAAGGGGAAGAAAAGAGG - Intronic
1112629815 13:101148404-101148426 ATCTATAAGGAAAAGGAGAGGGG - Intronic
1112951402 13:105001620-105001642 CATTATATGGAGAAGAGCAGTGG - Intergenic
1113285230 13:108839176-108839198 CTTTATAAGAAGAGGAAGAGAGG - Intronic
1113504775 13:110807830-110807852 CTTTAGTAGCAGAAGAGGAGGGG - Intergenic
1114058042 14:18992022-18992044 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1114104506 14:19409732-19409754 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
1114601031 14:23955531-23955553 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114605242 14:23990678-23990700 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114610715 14:24038310-24038332 CTCTGTAAGCTGAAGAAGAGGGG - Intergenic
1114914027 14:27239589-27239611 CTCTGAAAGGAGAGGAAGAGAGG - Intergenic
1116000148 14:39234243-39234265 ATTTAGGAGGAGAAGAAGCGGGG - Intronic
1116232097 14:42230069-42230091 CCTTTTAAGGGGAAGAAGAATGG + Intergenic
1116727957 14:48586588-48586610 CTTTAAAAGGTACAGAAGAGTGG - Intergenic
1116934431 14:50724548-50724570 TTTTTTAAGGAAAGGAAGAGAGG - Intronic
1117503495 14:56377261-56377283 CTTTATAAGGGAAAGAAGGAAGG - Intergenic
1118556093 14:67024423-67024445 CTTTATCAAGAGAAGTACAGGGG + Intronic
1118969407 14:70620564-70620586 CTTAGTATGTAGAAGAAGAGAGG + Intergenic
1119684839 14:76623356-76623378 CTTCATGTGGAGAAGAAGGGAGG - Intergenic
1120191143 14:81440852-81440874 GTTTATAGAGAGGAGAAGAGTGG - Intergenic
1120324404 14:83007034-83007056 CCTTATAAGAGGAGGAAGAGAGG - Intergenic
1120552799 14:85891865-85891887 CTTTATAAGAAGAGGAAGAGGGG - Intergenic
1120660748 14:87248170-87248192 CTTTATATGGAAATGCAGAGGGG + Intergenic
1120887454 14:89462983-89463005 CTTTTTAAGAAGAGGAAGAGAGG - Intronic
1121011454 14:90522574-90522596 ATTTGAAAGGAGCAGAAGAGCGG + Intergenic
1121244693 14:92453328-92453350 CTTTATAAGGGCAAGTAGTGAGG - Intronic
1121260721 14:92564227-92564249 ATTTATTTGGAGAGGAAGAGGGG + Intronic
1122250356 14:100434846-100434868 CTTTTTATGAAGAAAAAGAGCGG - Intronic
1123668872 15:22633511-22633533 CTTTTTAAAGAGAAAGAGAGAGG + Intergenic
1124363818 15:29057349-29057371 CTGTAAAATGAGTAGAAGAGAGG - Intronic
1124721954 15:32118126-32118148 CTTGATAAGAAGAGGAAGAGAGG + Intronic
1125302145 15:38266702-38266724 ATTTTTAAAGAGAAGGAGAGTGG + Intronic
1128578436 15:68791830-68791852 CTTTGTCATGAGATGAAGAGGGG + Intronic
1130318556 15:82818925-82818947 CTTTATTAGAAGAGAAAGAGAGG - Intronic
1131241779 15:90750623-90750645 CTATATGATGAGATGAAGAGAGG - Intronic
1131860751 15:96650864-96650886 CCTTTCAAGGAGAAGAATAGAGG + Intergenic
1132648171 16:1008554-1008576 CCGTATAAGGAGGAGAGGAGAGG - Intergenic
1133210383 16:4260344-4260366 CTTTATATTAAGAAGCAGAGAGG + Intronic
1133429663 16:5725651-5725673 CCATATAAGGAGAATCAGAGAGG + Intergenic
1133567970 16:7013028-7013050 CCTTAAAAGGAGAGAAAGAGAGG - Intronic
1133614827 16:7466425-7466447 CATTTTAAGGATAAGAAAAGAGG + Intronic
1133681067 16:8120332-8120354 TGTTATAAGGAGAACAAAAGTGG + Intergenic
1134469093 16:14506825-14506847 CTTTAAAAAAAGAAAAAGAGTGG + Intronic
1135891860 16:26364701-26364723 CTATAAAAGGAGAAGAATACTGG + Intergenic
1137892581 16:52178145-52178167 CTTTATAAGGACAAGAAGGGAGG + Intergenic
1138058944 16:53868274-53868296 CTATAAAAGCAGAAAAAGAGTGG - Intronic
1138691334 16:58771532-58771554 CTTGAGGAGGAGAAGAGGAGTGG + Intergenic
1139104915 16:63817150-63817172 CTACATTAGGAGAAGAAGATAGG + Intergenic
1139253559 16:65519705-65519727 CATTATAAAGAGAAGGGGAGAGG - Intergenic
1140129933 16:72151710-72151732 CTACGTAAGGGGAAGAAGAGAGG + Intronic
1140236287 16:73161886-73161908 CTTTCAACTGAGAAGAAGAGGGG + Intergenic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141229707 16:82153925-82153947 CCTTATAAGGAGGAGAGGTGAGG - Intronic
1141731352 16:85825099-85825121 CCTTATAAGAAAAAGCAGAGAGG - Intergenic
1141746134 16:85927687-85927709 GTTTATCAGGAGAAGAGGATGGG - Intergenic
1141999658 16:87656949-87656971 CCTTATAAGAAGAGGAGGAGAGG - Intronic
1142339111 16:89508874-89508896 CTTTAAAAGGCGAGGAAGACGGG - Intronic
1142496047 17:306856-306878 CATGAGAAGGAGAGGAAGAGAGG - Intronic
1142766715 17:2068494-2068516 CTTTATAAGGATAAAAACAAGGG + Intronic
1142835180 17:2580281-2580303 TTTTATAAGGAACAGAAGAGGGG - Intergenic
1144009739 17:11135571-11135593 TTTTTTAAGGATAAGAAAAGTGG - Intergenic
1144731735 17:17530010-17530032 TTGTATAAGGACATGAAGAGGGG + Intronic
1145801537 17:27689246-27689268 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
1147445343 17:40471865-40471887 CTTTATAAGAAAGGGAAGAGAGG + Intergenic
1147835585 17:43329038-43329060 ATTGATAAGGAGAAGAAGTTTGG + Intergenic
1149551589 17:57544435-57544457 CCTTATAAAGAAAAGAAAAGAGG - Intronic
1149744162 17:59078236-59078258 CTTTCTAAGGATAAGAGGTGGGG - Intronic
1150204503 17:63392069-63392091 TTCTATCAGAAGAAGAAGAGAGG - Intronic
1150245615 17:63672623-63672645 CTATAGAATGAGAAGAAAAGAGG + Intronic
1150922451 17:69497723-69497745 CTTTGTAAGGAGAAGCACTGTGG - Intronic
1151460492 17:74251512-74251534 ATGTAGAAGGGGAAGAAGAGAGG - Intronic
1152732415 17:81978758-81978780 CTTTTTATGGAGAAGAGGGGCGG + Intronic
1153691347 18:7597096-7597118 CTTTAGAAGGACAAGGAGGGTGG - Intronic
1153853154 18:9116214-9116236 CTTTATAGAGAAAAGAAGATAGG + Intronic
1153861890 18:9219600-9219622 CTGTTGAAGGAGAAGAGGAGAGG - Intronic
1155220288 18:23679145-23679167 CCTGATCATGAGAAGAAGAGTGG + Intergenic
1156253177 18:35371611-35371633 CTTTATAAGAAGAGGAAGAAAGG - Intronic
1156425621 18:37008859-37008881 CTTAAGAAGGGGAAAAAGAGAGG + Intronic
1156548743 18:37992191-37992213 TTTTATTAGGAAGAGAAGAGAGG + Intergenic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1157209904 18:45733243-45733265 CTAAAGAAGGAGAAGAAGACGGG + Intronic
1157630049 18:49086332-49086354 CTTTATAAGAGGAGAAAGAGAGG - Intronic
1157872840 18:51246383-51246405 CTTTATAAGAAGAGGAAGGCCGG + Intergenic
1158463154 18:57664898-57664920 CTTTGGAAGGAGAAGAACAATGG - Intronic
1158689121 18:59644417-59644439 CTTTGTAAGCTGAAGAAGACAGG - Intronic
1159079970 18:63725929-63725951 CTTTATAGGGACAATAGGAGGGG - Intronic
1159159633 18:64626806-64626828 CTACATATGGAGAAAAAGAGAGG - Intergenic
1159374853 18:67580115-67580137 CTTTATAAGAAAAGTAAGAGAGG + Intergenic
1160108840 18:76005958-76005980 AGTTATGAAGAGAAGAAGAGGGG - Intergenic
1160233256 18:77065327-77065349 CTTTGTAAGGAGAGGAAGAGAGG - Intronic
1160771928 19:835881-835903 CTTTATAAAGAGGAGAGGAAAGG + Intergenic
1161706692 19:5825455-5825477 CATTGTAAGGACAAGAAAAGAGG - Intronic
1162704749 19:12547066-12547088 CTTTTTTAGGGGAAGAGGAGGGG + Intronic
1164330194 19:24247017-24247039 ATTTTTAAGGAGAAAAAGAAAGG - Intergenic
1164378006 19:27706458-27706480 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
1165967167 19:39592178-39592200 CTTTATGAGGTGGAGGAGAGCGG + Intergenic
1166972168 19:46576314-46576336 CCTTATAGGAAGAGGAAGAGAGG - Intronic
1168050444 19:53825760-53825782 CTTTATAAGAAGAAGACAGGAGG + Intergenic
925185688 2:1844804-1844826 ATTTGGAAGGAGAAGACGAGGGG - Intronic
925803374 2:7624714-7624736 CTTTAGACAGAGAAGCAGAGGGG - Intergenic
925928033 2:8684834-8684856 GTTAATCAGGAGAAGAAAAGAGG + Intergenic
925934170 2:8737314-8737336 CTTAATAAGAGGAAGAAGAGAGG + Intronic
926154112 2:10441724-10441746 CTATATAAAGAGACGGAGAGAGG + Intronic
926485246 2:13446729-13446751 ATTTAAAAGGAGAAGATGTGAGG + Intergenic
926781808 2:16479880-16479902 CTTTATAAGTAAAAGAGGAGTGG - Intergenic
926814236 2:16784476-16784498 CCTTATAAGAAGAAGAAACGTGG + Intergenic
927922709 2:26985794-26985816 CTTTATAAGCAGGAGGACAGAGG + Intronic
927922767 2:26986214-26986236 CCTTATAAGGGGAAGCAGAAGGG - Intronic
929432429 2:41898338-41898360 CTCTAGATGGAGGAGAAGAGAGG + Intergenic
931330059 2:61271560-61271582 CTTTAAAAGGAGAAGAAAGGAGG + Intronic
931600068 2:63994187-63994209 GTTTGTAAGGAGAAAAAGAAAGG - Intronic
932439753 2:71726446-71726468 TTTTATAATGAGCATAAGAGAGG + Intergenic
932656839 2:73617872-73617894 CTCTTGAAGGAGAAGTAGAGAGG + Intergenic
932663511 2:73678148-73678170 CTCTTGAAGGAGAAGTAGAGAGG + Intergenic
933074302 2:77903929-77903951 CTTTATGAGAAAAAGAATAGGGG - Intergenic
933492767 2:83008712-83008734 CTTTATAAGAAGAGAGAGAGAGG + Intergenic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
934591500 2:95554982-95555004 ATTTAAAAGGAGAAGCAGAGCGG + Intergenic
935017695 2:99199878-99199900 CTTTATAATAAAAAGAAAAGAGG - Intronic
935142386 2:100364872-100364894 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
936654475 2:114468924-114468946 CTTTAGAACAAGAAGAAGAAGGG + Intronic
938078260 2:128353614-128353636 CTTTACAAGAAGAGGAAGGGAGG + Intergenic
938283177 2:130082204-130082226 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938333810 2:130470770-130470792 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938356007 2:130649897-130649919 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
938432433 2:131256696-131256718 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
939021237 2:136960730-136960752 CTTTACAAAGAGAAGAACAGAGG + Intronic
939565765 2:143784883-143784905 TTTTATCAGGAGAGGAAGAAAGG + Intergenic
939936404 2:148298650-148298672 CCTTCTGAGAAGAAGAAGAGAGG - Intronic
940046201 2:149413078-149413100 CTTTATAAAGTCAAGAAGAAGGG - Intronic
940450095 2:153826242-153826264 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940863084 2:158790161-158790183 CTTTATAAGAAGTGGAGGAGAGG + Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
942566534 2:177269688-177269710 TTTTATAAGAAGAAGAAAAAAGG + Intronic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
944001353 2:194842488-194842510 CTTTATAAGCACAAGATGGGGGG - Intergenic
944062659 2:195585398-195585420 GTTCTTAAGGAGAACAAGAGAGG - Intronic
944641031 2:201725774-201725796 CTTTATTTGGATAATAAGAGGGG + Intronic
945132661 2:206590504-206590526 CTTTAGAAGGAAAAGGAAAGAGG - Intronic
945635950 2:212351175-212351197 CCTTATAAGGAGAAGAAATTAGG + Intronic
945976486 2:216275133-216275155 ATTTATTGGGAGAAGCAGAGTGG - Intronic
946013486 2:216585190-216585212 CTTTATAAGAAGAAGAAATGAGG + Intergenic
946887458 2:224237096-224237118 CCTTATGAGAAGAGGAAGAGAGG - Intergenic
947102051 2:226631204-226631226 CTTCCTAGGGAGAGGAAGAGAGG + Intergenic
947280654 2:228450021-228450043 CTTTATAAGAAGAAGAAATTTGG + Intergenic
947844272 2:233231693-233231715 CTTTATAAGAAGAGGAAGAAAGG - Intronic
947938710 2:234029339-234029361 ATTAATGAGGCGAAGAAGAGAGG - Intergenic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
947960994 2:234237208-234237230 CTTTATAAGAAGGGGAAGAGAGG + Intergenic
948116669 2:235498521-235498543 TTTTCTAAGGAGAACCAGAGGGG - Intronic
948415629 2:237801032-237801054 CTTTTTAAGAATATGAAGAGCGG + Intronic
1169912257 20:10656583-10656605 CCTTGTAAGGAGAGGAAGATGGG + Intronic
1170095963 20:12646375-12646397 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1171422569 20:25027154-25027176 CTTTAGAAAGGGAAGAAGATGGG - Intronic
1172161412 20:32871151-32871173 ATTTAAAAGAAGAAGTAGAGAGG - Intronic
1172310830 20:33917211-33917233 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1172784221 20:37455726-37455748 CCTTAAAAGAAGAGGAAGAGAGG + Intergenic
1173042286 20:39475662-39475684 CCTTATAAGAAGAGGAAAAGTGG - Intergenic
1173238022 20:41266232-41266254 CTTCATAGGTAGAAGCAGAGTGG + Intronic
1174723771 20:52840200-52840222 CTTATCAAGGAGAAGAAGCGGGG + Intergenic
1175299937 20:57935585-57935607 CTTTACAAGAAGAGGAAGAGAGG - Intergenic
1175329333 20:58152260-58152282 GTTTGTATGGTGAAGAAGAGAGG - Intronic
1177242907 21:18484012-18484034 CTTTTTGAGGAAAAGAAAAGAGG - Intronic
1177366107 21:20139893-20139915 CTTTGGAAGGAGAAGAAATGGGG - Intergenic
1178534485 21:33401003-33401025 GTTTATACGGTGAAGAAGGGAGG - Intergenic
1178826046 21:36017810-36017832 CTCTGAAAGGGGAAGAAGAGAGG - Intergenic
1178846433 21:36177677-36177699 CTAAATAAGAAGAGGAAGAGAGG + Intronic
1180476527 22:15714638-15714660 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1180608519 22:17080145-17080167 CTTTATATGAAGAGGAAGATAGG - Intergenic
1181502788 22:23327751-23327773 CTTTGGAAGGTGAAGAGGAGAGG + Intergenic
1181653582 22:24276131-24276153 CTTTGGAAGGTGAAGAGGAGAGG + Intronic
1182679266 22:32065926-32065948 CTTGCTAAGCAGATGAAGAGTGG - Intronic
1183126492 22:35786884-35786906 GTTTCTAATGAGAAGAAGAGAGG - Intronic
1183459361 22:37940664-37940686 CTTAATAAAGTGGAGAAGAGGGG - Intronic
1184349410 22:43933912-43933934 CTTTATAAGCAGATGAGTAGAGG + Intronic
951064289 3:18246413-18246435 CTGTGTAAGCAGAACAAGAGAGG - Intronic
951295269 3:20926166-20926188 ATTTATAAAGAAAAGAAAAGAGG + Intergenic
951522806 3:23625347-23625369 CTTTATAAGAAGAGGAGAAGAGG - Intergenic
952836190 3:37604207-37604229 CTTTAAATGGAGAAGGAGTGGGG + Intronic
952948472 3:38497525-38497547 GATTATAAGGAAAAGGAGAGCGG - Intronic
953121207 3:40044439-40044461 CTTTATAGGGAGGATGAGAGAGG + Intronic
953790478 3:45943560-45943582 CTTTATATTGAAAAGAAGACAGG + Intronic
954918570 3:54169806-54169828 CTATATAAGGTGGAGAAGAAAGG + Intronic
955052642 3:55427457-55427479 TTTTATAGGTAGAAGAAGTGAGG - Intergenic
955513540 3:59705230-59705252 CTGTATAAGAAGAAAAAGTGTGG + Intergenic
955676102 3:61450443-61450465 TGCTATAAGGAGAAGTAGAGTGG - Intergenic
956171884 3:66439312-66439334 TTTTATAAGGGGAAAAACAGTGG - Intronic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
957353849 3:79057571-79057593 GTTTGTAAGGAGAAAAAGAAAGG - Intronic
957782733 3:84840598-84840620 CTTAATATGGAAAAGCAGAGTGG - Intergenic
958060802 3:88477356-88477378 CTTTATAAGCAGCTAAAGAGAGG - Intergenic
958414302 3:93855561-93855583 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
958794171 3:98689676-98689698 CTTTATAAACAGGAGAAGTGTGG + Intergenic
959114371 3:102158725-102158747 GTTTATTAGTAGAAGAACAGTGG + Intronic
959134122 3:102395388-102395410 CTTGATAAGGAGAATCAGAGAGG + Intronic
959542060 3:107551386-107551408 CTTTAAAAGAAGAAAAAGATGGG - Intronic
959556718 3:107728208-107728230 CTTTATAAGTAGAGGAATTGAGG + Intronic
959888329 3:111527289-111527311 GTTCATAAGGAGAAAAAGAAAGG - Intronic
960315386 3:116169502-116169524 CTTCATAATGTGAAGAAGAAAGG - Intronic
960626693 3:119688099-119688121 GTTTATAGGGAGATGAGGAGGGG - Intergenic
961364639 3:126391418-126391440 TTTCAAAAGGAGAAGAAGAAAGG - Intergenic
961626469 3:128267263-128267285 CTTTATAAGGACAAAGAGGGTGG - Intronic
962033839 3:131630020-131630042 CTATATGATGAGAAGAAGTGAGG + Intronic
962349139 3:134644135-134644157 CTTCTTAATGAGAAGAACAGGGG + Intronic
962370985 3:134820473-134820495 CTTTATGAAGAGAAGAATCGGGG + Intronic
962898788 3:139738799-139738821 CTTTAGAAGGAGGAGAAATGAGG - Intergenic
963021550 3:140876787-140876809 CATCAAAAGGAGAAGGAGAGGGG + Intergenic
963066764 3:141270369-141270391 CTTTAAAAGCAGACGATGAGAGG + Intronic
963118294 3:141752827-141752849 CTTTATAGGAAGAGGATGAGAGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963907246 3:150782785-150782807 CCTTATAAGAAGAGAAAGAGAGG + Intergenic
963982624 3:151556933-151556955 TTTTAGAAGGAGAGGAAGAGTGG + Intergenic
965863332 3:173173508-173173530 ATTTAAAAAGAGAGGAAGAGAGG + Intergenic
967839105 3:193990384-193990406 CTTTATAAGAAGAAGAAGAGAGG - Intergenic
969008949 4:4045123-4045145 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
969033527 4:4231957-4231979 CTTTATAAGAAGAGGAAAAGAGG - Intergenic
969233503 4:5848819-5848841 CTTTATAAGGAGAAGAAGAGAGG - Intronic
969421402 4:7099153-7099175 TTTTTTAAGGAAAAGAAGAAAGG - Intergenic
969914224 4:10474139-10474161 CTTTATAAAGAGACGGAAAGAGG - Intergenic
970166231 4:13241270-13241292 CATTCTAAGGAGAAGAAGCAAGG - Intergenic
970440663 4:16078559-16078581 CTTAATACAGAGAGGAAGAGTGG - Intronic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
970705405 4:18795573-18795595 TTTTATAAGGAGAAGAAGAGAGG - Intergenic
970821872 4:20226177-20226199 CTTTATAAGGGAAAGAAGGAGGG + Intergenic
970926716 4:21460607-21460629 CTTTATAAGAAGAGGAAGAGAGG - Intronic
971084470 4:23255782-23255804 GATCACAAGGAGAAGAAGAGTGG - Intergenic
971125473 4:23749480-23749502 CTTTATAAAGATAACAAAAGTGG + Intergenic
971312764 4:25539890-25539912 ATGCATAAGGAGTAGAAGAGAGG - Intergenic
972021334 4:34318079-34318101 TTTTTTGAGGAGAAGAAGGGAGG + Intergenic
972102495 4:35439443-35439465 TTTTATAAAGAGAAAAATAGAGG - Intergenic
972364520 4:38361760-38361782 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
972745705 4:41930529-41930551 CATTATAAGAAGAGAAAGAGAGG + Intergenic
972745829 4:41931943-41931965 CCTTATAAGAAGGGGAAGAGAGG + Intergenic
973269877 4:48251732-48251754 CTTTATTATAAAAAGAAGAGGGG + Intronic
973537311 4:51896413-51896435 CTGTCTACGAAGAAGAAGAGCGG - Intronic
973552000 4:52044889-52044911 CTTCATGAGGAAAAGGAGAGAGG - Intergenic
974326514 4:60421714-60421736 CTTTATGAGGAGCAGAACATAGG - Intergenic
974605392 4:64144394-64144416 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
974737535 4:65956986-65957008 TTTTATAAGAAGATGAAAAGTGG - Intergenic
974998852 4:69195885-69195907 GTTCATAAGGAGAAAAAGAAAGG - Intronic
975824955 4:78309612-78309634 CATTATAATGAGCAGTAGAGTGG - Intronic
976501094 4:85789976-85789998 CTTTATTGAGAGAAGAAAAGAGG - Intronic
978249690 4:106615564-106615586 CTTTGTAAACAGAAGAAAAGAGG + Intergenic
978291167 4:107142512-107142534 CTTTATAAGAAGAGGAAGAAAGG + Intronic
978715777 4:111840803-111840825 CTATATAAGGAGAAGACTGGAGG + Intergenic
978810989 4:112849713-112849735 CTGTATAAGGATTAGAAGAAGGG - Intronic
978931541 4:114319697-114319719 ATTTATAAAGAAAAGAAAAGAGG - Intergenic
980222761 4:129940929-129940951 CATTATAAAGAGAAGGAGAAGGG - Intergenic
980978694 4:139635422-139635444 GTTTGTAAGGAGAAAAAGAAAGG - Intergenic
981277516 4:142918929-142918951 AATTATAATGAGAAGCAGAGTGG + Intergenic
981993335 4:150950947-150950969 ATTTATAAGGTGAAAAAGAAGGG + Intronic
983190628 4:164750093-164750115 GTTCATAAGGAGAAAAAGAAAGG - Intergenic
983634519 4:169883522-169883544 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
983919507 4:173330995-173331017 CTCTTTAATGGGAAGAAGAGGGG - Intergenic
984192174 4:176619288-176619310 CTTTATATAAAGAAGAAGAAAGG + Intergenic
984331618 4:178327909-178327931 ATTTATGAGAAGAAGAAGATTGG + Intergenic
986396455 5:7335588-7335610 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
986510400 5:8500313-8500335 CTTTATAAGGAGAAGAAATTTGG + Intergenic
987782287 5:22454773-22454795 CCTTAATAGGAAAAGAAGAGAGG - Intronic
987820607 5:22961515-22961537 CCTTATAAGAAGAGGAGGAGAGG - Intergenic
987973551 5:24981449-24981471 CTTTAGAAGGCCAAGGAGAGGGG - Intergenic
988258579 5:28852213-28852235 CTTTATAAGAAGGAGAAGTTGGG + Intergenic
988443934 5:31263581-31263603 CTTTATAAGAAGAGGAAGAGAGG - Intronic
989006090 5:36813894-36813916 TTTAATAAGTAGAAGAACAGTGG - Intergenic
989318621 5:40109750-40109772 GTTTGTAAGGAGAAAAAGAAAGG - Intergenic
990716354 5:58641569-58641591 CTGAGTAAGGAGTAGAAGAGAGG - Intronic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
990822793 5:59861562-59861584 AATTATATGGAGAAAAAGAGAGG + Intronic
991192584 5:63892822-63892844 CTTTCTGAGGAGAACAAGACTGG - Intergenic
992659941 5:78949355-78949377 CTTTATAAGGATAAGAATACTGG - Intronic
993339366 5:86704252-86704274 CTTTAAAAGAAGATGAGGAGTGG - Intergenic
993380184 5:87198041-87198063 GTTTGTAATGAGTAGAAGAGAGG - Intergenic
994937825 5:106278734-106278756 ATTTAAAAAGAGAGGAAGAGAGG - Intergenic
995974561 5:118017407-118017429 CTTAATAAGGTGGAGATGAGAGG - Intergenic
996742988 5:126819121-126819143 TCTTAGAAGGCGAAGAAGAGAGG + Exonic
996987793 5:129588224-129588246 CTTTTTAGGAGGAAGAAGAGAGG + Intronic
997692752 5:135837840-135837862 CTTTATTAGCAGAATAAGAATGG + Intronic
998535247 5:142924255-142924277 CATCTTAAGGAGAAGAAGAAAGG - Intronic
998885904 5:146693209-146693231 ATTTAAAAAAAGAAGAAGAGAGG - Intronic
999537672 5:152535308-152535330 CTTTATAAGAGGAGGAAGAGAGG + Intergenic
999640016 5:153663027-153663049 CTTTGGAAGGAAAAGGAGAGTGG + Intronic
999789785 5:154928615-154928637 CTTTCTGAAGAGAAGAGGAGGGG - Exonic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1001426537 5:171626162-171626184 TTTTCTAAGAAGAAGAAGAAAGG - Intergenic
1001521811 5:172399651-172399673 GTTTGTAAGGAGAAAAAGAAAGG - Intronic
1001888586 5:175319072-175319094 CTTTATAAGAAGAGAGAGAGCGG + Intergenic
1002894052 6:1364772-1364794 CCTTAAAAGGAGAAGAAATGAGG - Intergenic
1003920172 6:10825480-10825502 CTTTAGAGGGAGAAGAAAAGAGG - Intronic
1004364894 6:15003630-15003652 TTGTATAAGGAAAGGAAGAGTGG + Intergenic
1005937213 6:30532482-30532504 CCTTATAAAGAGATGAAGAGAGG - Intergenic
1006782469 6:36641331-36641353 CTTTATAAGAAAAGGAAGTGTGG + Intergenic
1007392767 6:41560098-41560120 CATTATACAGAGAAGAAAAGAGG + Intronic
1007859444 6:44892283-44892305 CTTTATAAGATGAGGAAGAGAGG + Intronic
1008449317 6:51631886-51631908 CTTTTAAAGGAGAAGAGGAGAGG + Intronic
1008881234 6:56382611-56382633 TTTTATAAGAAGAGGAAGAGAGG + Intronic
1011436575 6:87344446-87344468 TTTTATAAGAAGAGGAAGAGAGG + Intronic
1013542450 6:111123899-111123921 TTTTAAAAGGAAAAGAAGAGGGG - Intronic
1013600625 6:111701099-111701121 CTTTATAAAAAAAAGAAGAAAGG + Intronic
1014104158 6:117544520-117544542 CTTGATAGGAAGAAGAAGAAAGG + Exonic
1014122320 6:117739759-117739781 CCTTACAGGGAAAAGAAGAGCGG + Intergenic
1014125329 6:117770324-117770346 CTTTATATGGAGAGAGAGAGAGG - Intergenic
1014292081 6:119570573-119570595 AGTTGTAAGGAGAACAAGAGAGG - Intergenic
1015100168 6:129468681-129468703 ATTTAAAAGGAAAAGAAGAAAGG + Intronic
1015323932 6:131904511-131904533 CTTTGGAATGAGAAGAAGAGCGG - Intergenic
1015327172 6:131936266-131936288 TTTTATAAGGAGAAGTAAATAGG - Intergenic
1015522297 6:134143819-134143841 CTTTATGAAAAGAGGAAGAGGGG + Intergenic
1015875374 6:137817229-137817251 CTTTATGCTGAGAAGAAGAAAGG + Intergenic
1016659861 6:146565824-146565846 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
1016712420 6:147189058-147189080 CTTTAAAAAGAGAAAAAGTGTGG + Intergenic
1017602917 6:156102978-156103000 ATGTATAAGGGGAAGAAGAGTGG - Intergenic
1019202492 6:170329813-170329835 CTTGATGAAGAGAAGAAGAGTGG - Intronic
1019868746 7:3737901-3737923 CATTAGAAGGGTAAGAAGAGTGG - Intronic
1020372953 7:7454500-7454522 CTTTACAAAAAGAAGAAAAGGGG + Intronic
1020596070 7:10209363-10209385 ATTTATAATGAGCAGAAGACTGG - Intergenic
1020909221 7:14107730-14107752 GTTTATATGGAGAAGAAGCAAGG + Intergenic
1022186519 7:27974787-27974809 ATTTATAAAGAAAAGAAAAGAGG + Intronic
1022573939 7:31479771-31479793 CTTTGTAGGAAGAGGAAGAGAGG + Intergenic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1023624276 7:42100735-42100757 CTTTCCAAGAAAAAGAAGAGGGG + Intronic
1024409388 7:49022551-49022573 ATTTATAAGGTGAAAAATAGAGG - Intergenic
1024553218 7:50581003-50581025 GTTTGTAAGGAGAAAAAGAAAGG - Intergenic
1024939485 7:54747059-54747081 CTTTCCAAGGAGGAGAAGACGGG - Intergenic
1024973017 7:55087858-55087880 CTCCAAAAGGAGAAGAGGAGAGG - Intronic
1025195110 7:56926570-56926592 CTTTAGAAGTAGGAGAAGAGGGG + Intergenic
1025676842 7:63650373-63650395 CTTTAGAAGTAGGAGAAGAGGGG - Intergenic
1025677275 7:63653298-63653320 ATTTACAAGGAGAAGGAAAGAGG + Intergenic
1025851314 7:65246956-65246978 CTGTAAAAGTAGATGAAGAGGGG + Intergenic
1026180584 7:68035949-68035971 CTTTATAAGAAGAGGAGGATGGG + Intergenic
1027025505 7:74849111-74849133 CATTACAAGAAGAAGAAGAAGGG - Intronic
1027062259 7:75095008-75095030 CATTACAAGAAGAAGAAGAAGGG + Intronic
1027833010 7:83204729-83204751 CTTCAAAAGGAGAAGAAAATGGG - Intergenic
1027844943 7:83361063-83361085 CTTTATAAGAAGAGGAAGGGAGG - Intergenic
1027993951 7:85399663-85399685 TTTTAGACGGATAAGAAGAGTGG + Intergenic
1028516602 7:91684155-91684177 CTTGAAAAGAAGTAGAAGAGTGG - Intergenic
1029673397 7:102049484-102049506 ATTTAGAAGTAGGAGAAGAGGGG + Intronic
1029795605 7:102891153-102891175 CTCTATAGGGACAGGAAGAGAGG + Intronic
1029890950 7:103930261-103930283 CATTATAAGAAGAAGAAATGTGG - Intronic
1030225955 7:107151406-107151428 TTTTAAGAGGAGAAGAAAAGAGG - Intronic
1030424384 7:109355262-109355284 ATTTATAAGGAAAAAAACAGGGG - Intergenic
1030561669 7:111094697-111094719 CTTTATCAGAAGGAGAGGAGAGG - Intronic
1030901173 7:115125680-115125702 CTTTATTATGAGAATAAAAGTGG - Intergenic
1030996885 7:116370507-116370529 CTTTATAAGAAGAAGAAGAGAGG + Intronic
1031075891 7:117211900-117211922 CTTTATTAGGATAAAAAGAGGGG + Intronic
1031297701 7:120024323-120024345 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1031347693 7:120689737-120689759 CTTTAGAAGGAGAAAAAAATGGG - Intronic
1031351119 7:120732151-120732173 GTTTATATGGAGAAGATAAGAGG + Intronic
1031677629 7:124631166-124631188 CTTTCTAAGGAGGAGAAGCTTGG - Intergenic
1031818365 7:126469093-126469115 CTTTATTAGGTGAAGGAGATGGG - Intronic
1032361437 7:131259181-131259203 CTTTCTAATGGTAAGAAGAGGGG - Intronic
1033006311 7:137568309-137568331 TTTTACCAGGAGAAGAAGAATGG - Intronic
1034074944 7:148222419-148222441 GTCTATAAGAAGAGGAAGAGAGG - Intronic
1036250222 8:7155788-7155810 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
1036367266 8:8131662-8131684 GTTTGTAAGGAGAAAAAGAAAGG - Intergenic
1036686094 8:10911661-10911683 ATCTATAAAGAGAAAAAGAGAGG + Intronic
1036883614 8:12534000-12534022 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
1038276729 8:26127527-26127549 CTTTATAAGAAGAGGAAGTTTGG - Intergenic
1038287923 8:26222605-26222627 CTTTAAAAAGAGAAGAATTGAGG - Intergenic
1038430947 8:27499094-27499116 CTTTATAAGAAGTGGAAGTGAGG - Intronic
1038586607 8:28795339-28795361 CCTCATAAGAAGAGGAAGAGAGG + Intronic
1038670211 8:29577084-29577106 CATTAAAAGGAGAGGAAAAGTGG - Intergenic
1039352052 8:36773683-36773705 CTTTATAAGGAAAAGTTGTGTGG - Intergenic
1039822757 8:41148178-41148200 TTCTAGAAGAAGAAGAAGAGAGG + Intergenic
1040139757 8:43896360-43896382 GTTTGTAAGGAGAAAAAGAAAGG - Intergenic
1040819123 8:51535811-51535833 CTTTTTAAGGAAAATAAGAGAGG - Intronic
1041735858 8:61109791-61109813 TTTTATAAGAAGAGGAGGAGAGG + Intronic
1041876010 8:62687928-62687950 CTTTAAAAGGAAAAGAAAAAGGG + Intronic
1042693536 8:71530162-71530184 CTTTATAAGAAGAGAAGGAGGGG + Intronic
1043067174 8:75589420-75589442 ATTAATAAAGAGAAAAAGAGAGG - Intergenic
1043151412 8:76721152-76721174 CTTTTGAAGGAGGAGAAGTGAGG + Intronic
1043794656 8:84521178-84521200 CCTTATAAGAAGTGGAAGAGAGG + Intronic
1047184985 8:122624741-122624763 CCTTACAAGAAGAAGAAAAGAGG - Intergenic
1047347326 8:124040764-124040786 CTTCAGAAGAAGAGGAAGAGAGG - Intronic
1047940217 8:129822156-129822178 CTTTATAAGGTAAAGAAGTTCGG - Intergenic
1048187827 8:132260531-132260553 CTAGATAAGAAGAGGAAGAGAGG + Intronic
1048193530 8:132311952-132311974 CGTTATAAACAGAAGAGGAGAGG + Intronic
1048407281 8:134136645-134136667 CTTTATAAAAAGAAGATGAGGGG + Intergenic
1049970081 9:814347-814369 GTTTATAATGAGAATAAGAATGG - Intergenic
1050258617 9:3817916-3817938 ATCCATAAGGAGAAGAAGAGTGG + Intergenic
1050479643 9:6076474-6076496 GTTTCCAAGTAGAAGAAGAGTGG + Intergenic
1051164008 9:14241802-14241824 GTCTATAAGGAGAGGAAGAATGG - Intronic
1051804434 9:20976218-20976240 TTTTAAAAAGAGAAGAACAGAGG + Intronic
1052687892 9:31777428-31777450 GTTTGTAAGGAGAAAAAGAAAGG - Intergenic
1053178597 9:35947957-35947979 CTTTATAAGGAGATCAAGGTGGG - Intergenic
1053346305 9:37380867-37380889 CTTTATAACGGGACGAAGAAAGG - Intergenic
1054882173 9:70155386-70155408 ATTGATCAGGAGATGAAGAGAGG - Intronic
1055093659 9:72388306-72388328 CTTTATAAGAAGAGAAAGAGAGG - Intergenic
1055415044 9:76072679-76072701 CATTATAAGGAGTAAAAGAGAGG - Intronic
1055669278 9:78584631-78584653 GTTTGTAATGAGATGAAGAGTGG + Intergenic
1056849627 9:90071457-90071479 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
1057623790 9:96659777-96659799 CTTTATATGGAGATTAAGTGTGG - Intergenic
1059214831 9:112551660-112551682 CTTTACCAGGTCAAGAAGAGAGG + Intronic
1059752424 9:117260328-117260350 CTTTAGAAGAAGAATAACAGTGG - Intronic
1062191042 9:135247991-135248013 GATTAAATGGAGAAGAAGAGAGG + Intergenic
1062618613 9:137409178-137409200 CTTTATAAGAGGAGGAGGAGAGG + Intronic
1185558703 X:1041475-1041497 CTTTATAAGAAGAAGACATGAGG + Intergenic
1185800703 X:3007899-3007921 CTTTATAAGAAGAGGAAATGAGG - Intronic
1185860845 X:3577954-3577976 GTTTATAATGAGAGGAACAGGGG + Intergenic
1186458274 X:9727921-9727943 CTTTACAGGCAGAAAAAGAGAGG - Intronic
1186539609 X:10387166-10387188 TTTTATCAGGAGAGCAAGAGTGG - Intergenic
1186586104 X:10874777-10874799 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1186684809 X:11914671-11914693 CTTTCTCTGGAGGAGAAGAGAGG - Intergenic
1186695481 X:12026258-12026280 ATTGATAAGGAAAAGAAGACAGG - Intergenic
1187586109 X:20663588-20663610 CTGGTTAAGGAGGAGAAGAGAGG - Intergenic
1187714736 X:22091729-22091751 CTTTATTAGGAGAAAAAGAATGG - Intronic
1188259877 X:28009606-28009628 TTATAAAAGGAGGAGAAGAGAGG + Intergenic
1188321235 X:28739791-28739813 CTTGGAAAGGAGATGAAGAGTGG - Intronic
1188409918 X:29859100-29859122 ATTTAAAATGAAAAGAAGAGAGG - Intronic
1188540172 X:31241094-31241116 CTTTATAACAAGAAGTACAGGGG - Intronic
1188577552 X:31670762-31670784 TTTTATAAGAAGAGGAAAAGAGG - Intronic
1188975700 X:36672249-36672271 GTTTATAAGGAATAGAAAAGTGG - Intergenic
1189080186 X:37962806-37962828 CTTTATTAAAAGAGGAAGAGGGG - Intronic
1189392135 X:40585251-40585273 CTTTACATGGAGAGGATGAGAGG + Intronic
1189557889 X:42164337-42164359 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
1189643962 X:43106185-43106207 CTTTATCAGTAAGAGAAGAGTGG - Intergenic
1189978564 X:46486846-46486868 GTTTGTAAGGAGAAAAAGAAAGG + Intronic
1190139889 X:47833550-47833572 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1191125234 X:56947201-56947223 GTTTGTAAGGAGAAAAAGAAAGG - Intergenic
1191928196 X:66339050-66339072 TTGTATAAGGTGAAGAAAAGTGG + Intergenic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1192714719 X:73627534-73627556 CTTTGGAAAGGGAAGAAGAGTGG - Intronic
1194247017 X:91526918-91526940 CTTTAAAGGGAGCAGAAGAAGGG + Intergenic
1194812038 X:98398919-98398941 CCCTATAAGAAGAGGAAGAGAGG + Intergenic
1195174100 X:102297994-102298016 CTTTATAAGAAGAGGAAAATTGG + Intergenic
1195184765 X:102389099-102389121 CTTTATAAGAAGAGGAAAATTGG - Intronic
1195857458 X:109346616-109346638 CTTGGAAGGGAGAAGAAGAGAGG - Intergenic
1196283412 X:113851113-113851135 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1198406277 X:136315785-136315807 CTTTATAAGAAGAAAAAGTGTGG + Intronic
1198723555 X:139651763-139651785 CTTTATACGGAGGAGCAGATCGG + Exonic
1199735978 X:150687097-150687119 CTTTACAAGAAGAGGAAGAGAGG - Intergenic
1200015157 X:153155895-153155917 AGTTATAAGGTGATGAAGAGTGG + Intergenic
1200291921 X:154883678-154883700 CTTTATAAGAATAGGAAGAGAGG - Intronic
1200338759 X:155379415-155379437 CTTTATAAGAATAGGAAGAGAGG - Intergenic
1200347710 X:155461277-155461299 CTTTATAAGAATAGGAAGAGAGG + Intergenic
1200694726 Y:6348983-6349005 CATCATAAGGGGAAGGAGAGGGG - Intergenic
1200861233 Y:7994884-7994906 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
1201040551 Y:9825727-9825749 CATCATAAGGGGAAGGAGAGGGG + Intergenic
1201475495 Y:14376914-14376936 GTTTGTAAGGAGAAAAAGAAAGG + Intergenic
1201565390 Y:15360105-15360127 CTTTATAAGGGAAAGAAGCAAGG - Intergenic
1201935731 Y:19408796-19408818 CTTTAGAAAGAGGAGAAGAGTGG + Intergenic