ID: 969233809

View in Genome Browser
Species Human (GRCh38)
Location 4:5851199-5851221
Sequence CTGTGTGAGTGGCATGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969233809_969233812 4 Left 969233809 4:5851199-5851221 CCTTCTGCATGCCACTCACACAG 0: 1
1: 0
2: 3
3: 25
4: 288
Right 969233812 4:5851226-5851248 AAAAGAACAGAAGCCCAGCTGGG 0: 1
1: 0
2: 4
3: 48
4: 568
969233809_969233811 3 Left 969233809 4:5851199-5851221 CCTTCTGCATGCCACTCACACAG 0: 1
1: 0
2: 3
3: 25
4: 288
Right 969233811 4:5851225-5851247 GAAAAGAACAGAAGCCCAGCTGG 0: 1
1: 0
2: 6
3: 43
4: 444
969233809_969233813 5 Left 969233809 4:5851199-5851221 CCTTCTGCATGCCACTCACACAG 0: 1
1: 0
2: 3
3: 25
4: 288
Right 969233813 4:5851227-5851249 AAAGAACAGAAGCCCAGCTGGGG 0: 1
1: 0
2: 3
3: 43
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969233809 Original CRISPR CTGTGTGAGTGGCATGCAGA AGG (reversed) Intronic
902553877 1:17235413-17235435 CGGTATGGGTGGCATGTAGATGG + Intronic
902690682 1:18108577-18108599 CTGTGTCAGTTACATGGAGAAGG + Intronic
904744809 1:32703867-32703889 CTGTGTGGGGGGCATGCATATGG + Intergenic
904805526 1:33128908-33128930 CTGTGTTAGTGGAAAGCACAGGG + Intergenic
906057492 1:42928379-42928401 GTGTGTGAGTGCCAGGCACAGGG + Intronic
908250729 1:62263656-62263678 CTGTGTGAGGGGGAAGGAGAGGG - Intronic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
910000013 1:82330631-82330653 CTCTGTGTGTGGCTTGCAGATGG + Intergenic
912306423 1:108572327-108572349 CTATGTGAGTGGGAAGCAGTGGG - Intronic
912745130 1:112239697-112239719 CTGTGGGAGTGACATGCAGTGGG + Intergenic
914240281 1:145848502-145848524 TTCTGTGAGTGTCATGGAGATGG - Exonic
914350604 1:146836390-146836412 ATGTGTCAGGGACATGCAGAGGG + Intergenic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
916692988 1:167208976-167208998 CTTTCTGTGTGGCAAGCAGAAGG - Intergenic
916881468 1:169023296-169023318 CTCTGTGCTTGGCTTGCAGATGG + Intergenic
917450506 1:175143931-175143953 GTATGTGAGTGACCTGCAGAGGG + Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918301902 1:183212316-183212338 CTCTGTGAGTGGTCAGCAGAAGG - Intronic
918860643 1:189821952-189821974 CACAATGAGTGGCATGCAGATGG - Intergenic
920337699 1:205256346-205256368 TTCTGTGAGTGGCCAGCAGAGGG - Intronic
923483611 1:234407769-234407791 ATGTGAGATGGGCATGCAGAGGG - Intronic
1064934236 10:20662335-20662357 ATGTGTGTGTGGCATGGGGAAGG - Intergenic
1065280280 10:24130342-24130364 ATGTGTGATTGGCATGCATTGGG + Intronic
1068654571 10:59561494-59561516 TTGTGTGAGTGACATAGAGAAGG - Intergenic
1069786054 10:70988645-70988667 CTGTGTGCGTCTCAGGCAGAGGG + Intergenic
1069794949 10:71046110-71046132 GTCTGTGAGTGGCAGGGAGACGG + Intergenic
1069861165 10:71472574-71472596 CTGGGTGAATGGCAGGCACATGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1071081479 10:81817790-81817812 CGGTATTAATGGCATGCAGAGGG - Intergenic
1071146719 10:82583681-82583703 CTGTATGAGTAGCATGCTTATGG - Intronic
1071290656 10:84186395-84186417 GTGTGTGTGTGGTGTGCAGAGGG + Intergenic
1072177325 10:92940603-92940625 CTGTGAGAATGGCATGCAATGGG + Intronic
1075280842 10:121136922-121136944 CTATGAGAGTGGGATGCAGTGGG + Intergenic
1075357303 10:121792076-121792098 CTGTTTGAGTGGCTGGGAGAGGG + Intronic
1075567007 10:123512236-123512258 CTCAGTGAGGTGCATGCAGATGG + Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076522947 10:131092247-131092269 CTGTGTGAGTGGCATTTTCATGG + Intergenic
1077273314 11:1691901-1691923 CTGTGTAGGTGGGATCCAGAGGG + Intergenic
1081511927 11:43783554-43783576 GGGTGTGGGTGGCAAGCAGAGGG - Intronic
1081802261 11:45868071-45868093 CAGGGTGAGAGGCATGGAGAGGG + Intronic
1083683591 11:64362441-64362463 CTGTGTGCCTGTCATTCAGATGG + Intronic
1083932899 11:65855577-65855599 CAGGGTGAATGGCACGCAGAGGG - Intronic
1084033754 11:66495607-66495629 CTGTGAGAGGGGCAGGCAGGTGG - Intronic
1084675265 11:70630327-70630349 CTGTGAGGGTGGCAGACAGAAGG + Intronic
1085531486 11:77194683-77194705 CTGTGTGCCTGGCACACAGATGG - Intronic
1085861668 11:80243084-80243106 ATGTGTGAGTGGCATGATGATGG - Intergenic
1087337833 11:96866582-96866604 CTGAGTCAGTGGGATGCACAAGG + Intergenic
1088238479 11:107750129-107750151 CTCTATGGGGGGCATGCAGACGG + Intergenic
1088377998 11:109162755-109162777 CTGTGTGAGTTCCATGAAGAAGG + Intergenic
1093071811 12:14713779-14713801 CTGTGTAACTGCCATGCAGAAGG + Intergenic
1093881928 12:24414588-24414610 CTGGGTGAGAGGCAGGCAGATGG - Intergenic
1096195467 12:49646595-49646617 CTGGGAGACGGGCATGCAGAGGG + Intronic
1096476121 12:51910283-51910305 GAGTGGGAGTGGGATGCAGAGGG - Intronic
1098964764 12:76775278-76775300 GTGTGTCAGTGGCTTGGAGAAGG + Intronic
1102029002 12:109729342-109729364 CTGGGTGAGGGGCATGCTGGGGG + Intronic
1103017832 12:117509315-117509337 CTGTTTGCCTGGCATTCAGAGGG - Intronic
1103590709 12:121990252-121990274 CTGTGTGCATGGCATTCAGGAGG + Intronic
1103898068 12:124287285-124287307 CCGAGTGAGAGGCATGCAGAGGG + Intronic
1104608410 12:130206579-130206601 CACTGTGAGTGGTATGGAGATGG + Intergenic
1104859445 12:131916864-131916886 ATGTGTGTCTGGCCTGCAGAGGG + Intronic
1106032381 13:26014904-26014926 CTCTGTGTCTGGCATACAGAAGG - Intronic
1107072415 13:36285696-36285718 CTCTGTAAGTGGCAAGCAGCCGG - Intronic
1108114112 13:47109112-47109134 ATGTGTGAGATGCAAGCAGATGG - Intergenic
1109237616 13:59843944-59843966 CTGTATGAGTGGCGGGCAGGAGG + Intronic
1110064416 13:71085875-71085897 CAGTGTGAGTGTGATGTAGATGG + Intergenic
1111227568 13:85294460-85294482 GTGTGTGAGTGGCAGGTAGCTGG + Intergenic
1112520315 13:100089079-100089101 CTGTGTGAGAGGTCAGCAGAGGG + Exonic
1112825032 13:103382265-103382287 CTCTGTTAGGAGCATGCAGAAGG - Intergenic
1115700292 14:35946752-35946774 CTCTGTGAGTGTCTTGAAGAAGG + Intergenic
1117111085 14:52455410-52455432 CTGTGTGTCTGGCAAGCAGCAGG + Exonic
1119196011 14:72717068-72717090 CTGTGTAAGTGGGTTGTAGATGG - Intronic
1119407428 14:74407411-74407433 CCGTGAGAGTGGCTTGCTGAGGG - Exonic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119889246 14:78170406-78170428 CTCTGTGAGTTGCATGCAAGAGG - Intergenic
1120137830 14:80890626-80890648 CAGGGTGAGGGGCAAGCAGAGGG + Intronic
1120979915 14:90280313-90280335 CTCTGTGAGTGCCACGCACAGGG + Intronic
1121794962 14:96727230-96727252 CTCTCTGACTGGAATGCAGAAGG - Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123173498 14:106396654-106396676 CTGTGTGAGAGACATGGTGAGGG - Intergenic
1123761565 15:23437379-23437401 CGGTGTGAGTGCCAGGCAGACGG - Intergenic
1124122199 15:26897381-26897403 CTCTGTGCTTGGCTTGCAGATGG - Intronic
1124135215 15:27029220-27029242 CTGTGTGAGTTGGAAGCAGCTGG + Intronic
1124493555 15:30173099-30173121 GTGTGTGTGTGGCATGTAGTAGG + Intergenic
1124493564 15:30173189-30173211 GTGTGTGTGTGGCATGTAGTAGG + Intergenic
1124552025 15:30690345-30690367 CTGTGTGTGGGGCACACAGAAGG + Intronic
1124679218 15:31715327-31715349 CTGTGTGTGGGGCACACAGAAGG - Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1128511925 15:68318709-68318731 CTGTGTGTGTGGCAAGCAAGGGG + Intronic
1128577028 15:68783290-68783312 CGGTGTGAGAGGCCTCCAGAAGG - Intronic
1129065703 15:72902221-72902243 CTGTGTGCATGGCATGGAGAAGG - Intergenic
1129666059 15:77579970-77579992 GCGTGTGCCTGGCATGCAGAAGG - Intergenic
1130386557 15:83417109-83417131 CTGTCTCCGTGGCTTGCAGAGGG + Intergenic
1130639897 15:85662534-85662556 CTGTGTGGCTGGGATGCATATGG + Intronic
1130874922 15:88005518-88005540 CAGTGGGAGAGCCATGCAGAGGG - Intronic
1130890554 15:88130026-88130048 CTGTCTGCTTGGCTTGCAGATGG - Intronic
1131096250 15:89655762-89655784 CTGTGTGAGTGGCGTGCAGGAGG - Intergenic
1131298323 15:91172215-91172237 CTGTGGGACAGGGATGCAGAGGG - Intronic
1132038715 15:98506740-98506762 CTGCCTGGGGGGCATGCAGAAGG - Intronic
1132562737 16:605462-605484 GAGTGTGAGAGGCCTGCAGAGGG - Intronic
1132773659 16:1579623-1579645 CAGTGTGTGTGGGATGCAGACGG + Intronic
1132959233 16:2612886-2612908 CTGTGGGAGTGGCTCGCAGGTGG + Intergenic
1132972293 16:2694861-2694883 CTGTGGGAGTGGCTCGCAGGTGG + Intronic
1133531962 16:6663623-6663645 CTCTGTGAGTCTCATCCAGATGG - Intronic
1133817736 16:9210981-9211003 CTGTGTGCCTGGCATGAAGTAGG + Intergenic
1133865000 16:9633993-9634015 CTGTGTACTTGGCTTGCAGATGG + Intergenic
1134067829 16:11240657-11240679 CTCTGTGCCTGGCATGCAGAAGG + Intergenic
1134815184 16:17199880-17199902 GTATGTGAGAGGCAGGCAGAGGG + Intronic
1135112027 16:19697808-19697830 CTGAGTGTGTGGCCTGGAGAGGG + Intronic
1135863184 16:26076223-26076245 CTGTGTGGGTTCAATGCAGAGGG + Intronic
1137435107 16:48448377-48448399 CAGTGTGGATGGCATGCAGTGGG - Intronic
1138024978 16:53515211-53515233 CTGTGTCCCTGGCTTGCAGATGG - Intergenic
1139330003 16:66180508-66180530 CTGTGTGAATGGCATGCACATGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139983432 16:70879149-70879171 ATGTGTCAGGGACATGCAGAGGG - Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140529891 16:75656096-75656118 CAGTGTGATTGGAATGCAGAGGG + Intronic
1141613463 16:85197104-85197126 CTCTGTGCCTGGCATGCAGGAGG - Intergenic
1142493448 17:293246-293268 CTGCATGAGTGGCAGGCGGAGGG - Intronic
1142598197 17:1039774-1039796 CTGTGAGGGTGGCAAGCAGCAGG + Intronic
1143070748 17:4290894-4290916 ATGTGTGCCTGGCATGCAGTAGG - Intronic
1144295818 17:13873975-13873997 CTGTCTCTGTGGCTTGCAGATGG - Intergenic
1144537751 17:16107456-16107478 CTGTCTTTGTGGCTTGCAGATGG - Intronic
1144661962 17:17076696-17076718 CTGTCTGGGTGGCATGAACAGGG - Intronic
1147240426 17:39087103-39087125 ATGGGTGAGTGGGGTGCAGAGGG + Intronic
1147999643 17:44380227-44380249 CTATGTGAGTGGCATGAAGGGGG - Exonic
1149636691 17:58176805-58176827 CTGTGTGTGTGTGCTGCAGAGGG + Intergenic
1149645682 17:58239852-58239874 CAGTGTGAGAGGCTTGCCGAGGG + Intronic
1150171126 17:62996025-62996047 CTCTGTGAAAGGCATGCTGAAGG - Intergenic
1151110093 17:71666197-71666219 CTGAGTAAGTGGCATGGAAACGG + Intergenic
1151555567 17:74844841-74844863 CTCCGTGAGTGGCATGTAGATGG - Intronic
1151724355 17:75875845-75875867 CTGTGCGAGAGGCTGGCAGAGGG + Intronic
1152299654 17:79487616-79487638 CTGGGTGAGTGGCATGGAGCTGG + Intronic
1152403885 17:80085615-80085637 CTTTGTGAGTGGGCTGCAGAGGG - Intronic
1156470693 18:37375738-37375760 CTGAGTGTGTGGGATGCAGCCGG + Intronic
1156853283 18:41753423-41753445 TTGGGTGAATGGCATGAAGAAGG - Intergenic
1157154535 18:45253083-45253105 CTGGGTGATTCGGATGCAGAAGG - Intronic
1157898000 18:51486772-51486794 CTGTGTGAATGGGTTGCTGAAGG + Intergenic
1160226031 18:77011585-77011607 CTCTGGGAGTGGCAGGCAGCCGG - Intronic
1161093659 19:2376320-2376342 CTGAGTGAAGGGCATGGAGATGG - Intergenic
1163588448 19:18176769-18176791 CTGAGAGAGTGGCAAGGAGAGGG + Intronic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1164037646 19:21468327-21468349 CCGAGTGAATGACATGCAGATGG + Intronic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165137644 19:33679978-33680000 CTGTCGGAGTGTCCTGCAGAAGG - Intronic
925818015 2:7772171-7772193 CAGTGTGGGTGGCAGGCAAAAGG - Intergenic
925858139 2:8150266-8150288 TCCTGTGAGAGGCATGCAGACGG - Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
927455381 2:23244429-23244451 ATGTGTGTGTGGCATGTATAAGG - Intergenic
929575274 2:43047820-43047842 GTGTGTGGGTGGTATGCAGTAGG - Intergenic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
932002661 2:67898912-67898934 CCCTGGGGGTGGCATGCAGAAGG - Intergenic
932961858 2:76421731-76421753 CTCTGGCAGTGTCATGCAGAAGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934656989 2:96121586-96121608 CTGTGTAACTGGCATGGGGAGGG - Intergenic
934722891 2:96594108-96594130 CAGTCTGAGTGGCAGCCAGAAGG - Exonic
935045747 2:99480569-99480591 TTGTGTGGGTGGAATGCACAAGG - Intronic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935609544 2:105006723-105006745 CTGTGTGACTGCAATCCAGAGGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938127871 2:128687387-128687409 GTGTGTGAGTGGTATGAAGTGGG + Intergenic
939566852 2:143795333-143795355 CTGTGAGAGTTCCATGCAGCTGG - Intergenic
940856477 2:158732265-158732287 CTGTGCTAGGGGCATTCAGAAGG - Intergenic
942705883 2:178771443-178771465 ATCTGTGAGTGGCTTGGAGATGG + Exonic
943782186 2:191836953-191836975 CTGTATCAGTGACAGGCAGAGGG + Intronic
945578185 2:211558372-211558394 CTTTGTAAGTGGGAGGCAGAAGG - Intronic
946474641 2:219995675-219995697 CTGCGTGTGTGGTGTGCAGAGGG + Intergenic
948996785 2:241584793-241584815 ATGAGTGTGTGGCATGCAGTGGG - Intronic
949070847 2:242023145-242023167 CTGTTTGAGGGTCATGCAGCTGG + Intergenic
1170221754 20:13948744-13948766 CTTTCTGTGTGGCATGCAGTAGG - Intronic
1172314361 20:33942277-33942299 TTTTGTAAATGGCATGCAGAGGG + Intergenic
1173137025 20:40447554-40447576 CAGTGGCAGTGGCATGCAGTTGG + Intergenic
1173464468 20:43270010-43270032 CTCTGTGAGTGGGATACAGTGGG + Intergenic
1174157661 20:48527106-48527128 CTGTGTCGCTGGCCTGCAGAAGG - Intergenic
1174174876 20:48638131-48638153 CTCTGTGTGTGGCATGCACTTGG - Intronic
1175666877 20:60868752-60868774 CGGTGTGAGTGGGACGTAGAGGG - Intergenic
1176762564 21:12970266-12970288 CTGTGTGAGTTGAATACACACGG + Intergenic
1177932505 21:27302348-27302370 ATGTGTGAGTGGCTTCCAAAGGG + Intergenic
1179155506 21:38847494-38847516 TCCTGTGAGTGGCATGCAGAGGG - Intergenic
1179726286 21:43343239-43343261 CTGTGTGGGTGGCCTTCAGAGGG + Intergenic
1180142106 21:45898953-45898975 CTGTGAGGACGGCATGCAGAGGG - Intronic
1181105030 22:20569193-20569215 ACGTGTTAGTGGAATGCAGATGG + Intronic
1181315235 22:21966758-21966780 CTGTCTGTCTGGAATGCAGAAGG - Intronic
1181319083 22:21990926-21990948 CTGAGTGAGTGGCCAGAAGAGGG + Intergenic
1181783163 22:25207406-25207428 CTGTGGGAGAGGCGTGCTGAAGG + Intergenic
1182483079 22:30622314-30622336 CTGTGGCAGTGGCATCCAGACGG + Intronic
1182509293 22:30807574-30807596 CTGTGTGAGAGGCAGGGAGCTGG - Intronic
1184189414 22:42885076-42885098 CTGTGTGAGGGGGATGGAGTGGG - Intronic
1184781949 22:46654097-46654119 CGGTGTGGCTGGCATACAGAAGG - Intronic
1184835187 22:47016799-47016821 CTGCCTGGGTGGCATGCGGAGGG + Intronic
1185029292 22:48433231-48433253 CTGGGTGACTGGCATCCAGTAGG - Intergenic
1185227540 22:49661417-49661439 CTGTGTGAGTGGCAGGGCCAAGG - Intergenic
950553505 3:13681658-13681680 GTGTGTGAGTGACTCGCAGAAGG + Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
952314325 3:32219333-32219355 ATGTGTAAGTAGCATGCACAAGG + Intergenic
954580592 3:51700911-51700933 CTGTGTCAGTGGCATGCACCTGG - Intronic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
956192434 3:66620654-66620676 GTGGATGAGTGGCAGGCAGATGG - Intergenic
956321703 3:68004847-68004869 CAGTGAGAGTGACATGCAGGAGG + Intronic
959116947 3:102189767-102189789 CTGTGGGTGTGGCATGAGGAAGG + Intronic
961601388 3:128064911-128064933 CTGTGCGTGTGGCCAGCAGATGG - Exonic
962027375 3:131562614-131562636 CTGTGTGTGTGGTATAAAGAAGG + Intronic
964276712 3:155016378-155016400 CTGTGTGGGTGGCTTTCTGAAGG - Intergenic
965513489 3:169594693-169594715 CTGTGTGAAATGCCTGCAGATGG - Intronic
966890855 3:184406512-184406534 CTGTGTGAGTGGGGTGCGGGGGG + Intronic
967137034 3:186521346-186521368 AGGTGTGGGTGACATGCAGAAGG + Intergenic
967850923 3:194082166-194082188 CTCTGTGACTGGCATTCAGCTGG - Intergenic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
971290964 4:25339042-25339064 CTCTCTCTGTGGCATGCAGATGG + Intronic
972106437 4:35494345-35494367 CTCTGTGGATGGCATGCTGATGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973739166 4:53902366-53902388 GTGTGTGTGTGGCATGCGGGCGG + Intronic
974103861 4:57445643-57445665 CTGTTTGGGTGGCAGGCAGGAGG + Intergenic
976318279 4:83682869-83682891 CTGTTTTAGTGGCAAGAAGAAGG - Intergenic
978257389 4:106709063-106709085 CTGTGTGTGAGGCATACTGATGG - Intergenic
980651873 4:135727192-135727214 CTGTGGTAGAGGCATGGAGATGG - Intergenic
981477718 4:145204598-145204620 CTGGGTGACTGACATACAGAGGG + Intergenic
981582298 4:146261834-146261856 ATGTGAGAGTGGCATAGAGAGGG - Intronic
984469410 4:180147805-180147827 CTGTGAGAGGAGGATGCAGAAGG - Intergenic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
985271477 4:188197899-188197921 CTGTATGGGGAGCATGCAGACGG - Intergenic
985544966 5:504840-504862 CTGGTTGAGTGGCATACAGCGGG + Intronic
985966730 5:3343502-3343524 CTGTGTGAGTAGCCTACACAGGG - Intergenic
986338057 5:6769463-6769485 CTCTGTCAGTAGAATGCAGAGGG + Intergenic
987050712 5:14144618-14144640 CTGTGTGGGTGGCGTGGAGGTGG + Intronic
989827029 5:45869745-45869767 GTATGTGACTGGCATGCAAATGG - Intergenic
990191318 5:53263301-53263323 ATGTGTGAGTAGAAAGCAGAGGG - Intergenic
990580657 5:57164418-57164440 CTGTGTTAGAGGCATGTACAGGG - Intergenic
990832239 5:59972187-59972209 CTGCCAGAGGGGCATGCAGAGGG + Intronic
992758100 5:79928076-79928098 CTCTTTGAGTCTCATGCAGAAGG + Intergenic
993861804 5:93145399-93145421 CTGTGTCAGTGGGATGTACAAGG - Intergenic
996473555 5:123888181-123888203 CTGTGTGAGTGTCTGGGAGAGGG + Intergenic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
1000324071 5:160158745-160158767 CTGTCTGACTGTCATGAAGAGGG + Intergenic
1000704762 5:164496986-164497008 GTGTGTGTGTGTCATGGAGAGGG + Intergenic
1002803444 6:549058-549080 CTGTGGGGGCGGCACGCAGAGGG + Intronic
1003231986 6:4262484-4262506 CTGAATGAGTGGCATAGAGATGG + Intergenic
1004367018 6:15021243-15021265 GTGTGTGTGTGGCAGGCACATGG - Intergenic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1007224209 6:40301618-40301640 CTGGGTGATGGGCCTGCAGAAGG + Intergenic
1009494236 6:64328893-64328915 ATGTGTGAGATGCAAGCAGATGG + Intronic
1010152836 6:72755930-72755952 CTGTGGCAGAGGCATGCAGGAGG - Intronic
1012496816 6:99842832-99842854 CTGTGTGAGTAGCATCCACCTGG + Intergenic
1015728886 6:136327725-136327747 TTGTGTTAATGGCAGGCAGAAGG + Intergenic
1015811470 6:137165639-137165661 ATGTGTGAGATGCAAGCAGATGG + Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017433886 6:154397631-154397653 GTGTGTGAGATGCATGCACAGGG + Exonic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018831767 6:167448843-167448865 CTGTGTGTGTTCCATGCTGAAGG + Intergenic
1018885192 6:167929511-167929533 CTGTGTGAGTGACCTGAGGAGGG - Intronic
1019191798 6:170255688-170255710 CTGTGTGAGTGGCGTCCACTGGG + Intergenic
1019723355 7:2586903-2586925 CTGTGGGAGTGTTAGGCAGAGGG + Intronic
1021093659 7:16511268-16511290 CTGTCTCAGTGGCATGAAAAAGG + Intronic
1022201807 7:28124259-28124281 CTCTTTGTGTGGCTTGCAGATGG - Intronic
1022585631 7:31605954-31605976 CTGTGAGACTGCCATGCAGGTGG - Intronic
1023473056 7:40545837-40545859 CTGTGTGATGGGGATGAAGATGG + Intronic
1024492448 7:50001031-50001053 CTGTCTATTTGGCATGCAGATGG - Intronic
1026910818 7:74090790-74090812 CACTGGGAGGGGCATGCAGAGGG - Intronic
1027492689 7:78849456-78849478 CAGAGTGAATGCCATGCAGAAGG + Intronic
1028445509 7:90917762-90917784 CTGTGAGAATGCCAGGCAGATGG + Intronic
1029165896 7:98590256-98590278 TTGTGTGAATGGCAGACAGAAGG - Intergenic
1029793157 7:102866641-102866663 TTGTGTGTGTTCCATGCAGATGG + Intronic
1030655453 7:112162540-112162562 GTGTGTGGGTGGCAGGGAGAGGG - Intronic
1031420418 7:121544981-121545003 CTATGTGAGTCACATGGAGAAGG - Intergenic
1032485750 7:132286234-132286256 CTCTGTGTGGGGCATGCAGTGGG + Intronic
1032519872 7:132535725-132535747 CTGCCTGTGTGGCCTGCAGAGGG - Intronic
1032978603 7:137254446-137254468 CTTTGGGAGTGGCATAGAGAAGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033983230 7:147191815-147191837 CTGTGGCAGTGTTATGCAGATGG - Intronic
1036207313 8:6814883-6814905 CTGTGTGAGTGGCCTGGACCTGG - Intronic
1039376325 8:37037864-37037886 CTGAGTGTGTTGCCTGCAGATGG - Intergenic
1039868981 8:41529434-41529456 CTGTGTGGGTGGCACTGAGAGGG + Intronic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1041849879 8:62378799-62378821 CTCTGCTAGTGCCATGCAGAAGG + Intronic
1044371382 8:91415428-91415450 CTGTGTGTGTGGCATCCATCTGG + Intergenic
1045393319 8:101736426-101736448 CAGTGTAATTGGCATGCAGTAGG - Intronic
1045426007 8:102066451-102066473 CTGTGTGAGTGGCACGGTGCTGG + Intronic
1048161545 8:132026169-132026191 ATGTATGAGTTGCATGCAGTGGG + Intronic
1048317009 8:133369992-133370014 CAGTGTGAGGGGCAGGCAGAGGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1050584556 9:7097070-7097092 ATGTGGGAGTGGGATGAAGAAGG - Intergenic
1052354470 9:27490068-27490090 CTTTGTGTGTGCAATGCAGAGGG - Intronic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1053313184 9:37032321-37032343 ATGTGTGAGTGTCATGGAGAGGG - Intronic
1056303591 9:85267857-85267879 CTCTGAGCGTGGGATGCAGAAGG - Intergenic
1056723447 9:89090700-89090722 GGGAGTGAGTGGCCTGCAGAAGG + Intronic
1056767161 9:89451835-89451857 CTGCGTGCATGACATGCAGAAGG - Intronic
1060875664 9:127081879-127081901 CTGTGGGAATGCCACGCAGATGG + Intronic
1061001356 9:127904710-127904732 CTGTGAGAGTGGCGGGCAGGTGG + Intronic
1061919366 9:133774312-133774334 CTGTGTGCCTGGCCTGCAGGAGG - Intronic
1062068069 9:134539634-134539656 CTGTATGGGAGGCGTGCAGATGG + Intergenic
1062106383 9:134757225-134757247 CTGTGTGTGTGGCATGAATGAGG + Intronic
1186432849 X:9519768-9519790 CTGGGAGAGTGGCAAGGAGAGGG + Intronic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1189326288 X:40113519-40113541 CTGTGTGGTTGGCCTTCAGAGGG - Intronic
1191190556 X:57662167-57662189 TTGAGTGAGTGGCAGACAGAGGG + Intergenic
1191853726 X:65605860-65605882 CTGTGAGAGTGACACACAGAAGG - Intronic
1192083990 X:68077002-68077024 GTGTGGGAGTGGCCTGGAGAGGG + Intronic
1192132733 X:68568178-68568200 CTTTGTCAGTGGCATGAAAATGG - Intergenic
1192139636 X:68636716-68636738 CTCTGTGAGTGCTATGCAAATGG - Intergenic
1194852678 X:98888758-98888780 CTGCATGTGTGGCATGAAGAGGG - Intergenic
1196744408 X:119056558-119056580 CTTTGTTAGAGGCAGGCAGATGG + Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1198230411 X:134683837-134683859 CTGTGTGGGTACCATGCATAAGG + Intronic
1200127813 X:153825067-153825089 CTGGGTGCGTGGCATTCAGCAGG - Intronic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1201266349 Y:12210814-12210836 CTCTGTGCATGGCATGCAGGAGG + Intergenic
1201377822 Y:13341462-13341484 ATGTGCGAGAGGCAAGCAGATGG + Intronic