ID: 969237310

View in Genome Browser
Species Human (GRCh38)
Location 4:5874731-5874753
Sequence AAGAGGAAAGGAAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15064
Summary {0: 1, 1: 6, 2: 120, 3: 1612, 4: 13325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969237310 Original CRISPR AAGAGGAAAGGAAAGATGGA AGG Intronic
Too many off-targets to display for this crispr