ID: 969238935

View in Genome Browser
Species Human (GRCh38)
Location 4:5887370-5887392
Sequence CCATGTATGCAGGAGCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 396}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969238935_969238943 12 Left 969238935 4:5887370-5887392 CCGGGCTGCTCCTGCATACATGG 0: 1
1: 0
2: 0
3: 27
4: 396
Right 969238943 4:5887405-5887427 CGCATCCCTCAGGAACAGTCAGG 0: 1
1: 0
2: 1
3: 3
4: 78
969238935_969238946 30 Left 969238935 4:5887370-5887392 CCGGGCTGCTCCTGCATACATGG 0: 1
1: 0
2: 0
3: 27
4: 396
Right 969238946 4:5887423-5887445 TCAGGCTCCACGCTGATGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 174
969238935_969238940 2 Left 969238935 4:5887370-5887392 CCGGGCTGCTCCTGCATACATGG 0: 1
1: 0
2: 0
3: 27
4: 396
Right 969238940 4:5887395-5887417 TCCAGTGGTCCGCATCCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969238935 Original CRISPR CCATGTATGCAGGAGCAGCC CGG (reversed) Intronic
900281764 1:1874257-1874279 CCAGGAATTCAAGAGCAGCCTGG + Intronic
900574175 1:3374856-3374878 GCAGGTGAGCAGGAGCAGCCAGG + Intronic
900593731 1:3471182-3471204 CCCTATATGCAGGAGGACCCCGG + Intronic
901503844 1:9671653-9671675 CCAGGAATTCAAGAGCAGCCTGG - Intronic
902625449 1:17673668-17673690 CAAGGCATGCAGGGGCAGCCGGG - Intronic
905173237 1:36121509-36121531 TCAGGTGTGCAAGAGCAGCCTGG + Intronic
905237659 1:36561211-36561233 CCAGGGATGCAGGAGCACGCGGG - Intergenic
905325292 1:37147566-37147588 CCATGTATGTGGGAGCAGGGAGG - Intergenic
905829625 1:41054990-41055012 CCATGTGTTCAAGACCAGCCTGG - Intronic
905978665 1:42202743-42202765 CCAGGTATTCAAGACCAGCCTGG - Intronic
906698578 1:47841399-47841421 CTATATCTGCAGGGGCAGCCAGG + Intronic
908008820 1:59754788-59754810 CCATGTATGAGAGAGCTGCCAGG - Intronic
911174940 1:94809430-94809452 CCAGGAATGCAAGACCAGCCTGG - Intergenic
911256070 1:95634810-95634832 CCATGAAGGCAGAAGCACCCAGG - Intergenic
912454558 1:109788931-109788953 CCCTGGAGGCACGAGCAGCCTGG - Intergenic
912937715 1:114018483-114018505 CCAGGCATTCAAGAGCAGCCTGG - Intergenic
913298982 1:117350677-117350699 CCAGGAATTCAAGAGCAGCCTGG - Intergenic
914462410 1:147897411-147897433 CTATGTTAGCAGGAGAAGCCTGG + Intergenic
914770673 1:150681855-150681877 CCATGAATTCAAGACCAGCCTGG + Intronic
914874695 1:151504180-151504202 CCAGGAGTTCAGGAGCAGCCTGG + Intergenic
914883621 1:151567108-151567130 CCAAGAATTCAAGAGCAGCCTGG - Intronic
915494999 1:156276023-156276045 CCAGGAATTCAGGACCAGCCTGG - Intronic
919217920 1:194584153-194584175 CCAAGTATTCAAGACCAGCCTGG + Intergenic
920899359 1:210091477-210091499 CCAGGAATTCAGGATCAGCCTGG + Intronic
922103584 1:222493758-222493780 CCATGAATTCAAGACCAGCCTGG - Intergenic
922263897 1:223966273-223966295 CCATGAATTCAAGACCAGCCTGG - Intergenic
923385985 1:233465724-233465746 CCAGGAATTCAGGACCAGCCTGG + Intergenic
924345744 1:243071269-243071291 CCATGAATTCAAGACCAGCCTGG - Intergenic
924547207 1:245040730-245040752 CCATGAGTTCAGGACCAGCCTGG + Intronic
924865128 1:247970868-247970890 TCATGCATGCAGGAGGAGACAGG + Intronic
924942750 1:248823870-248823892 CCAAACATGCAGGAGCATCCTGG + Intronic
1062983553 10:1745719-1745741 CCATGAAGCCTGGAGCAGCCTGG + Intergenic
1063385298 10:5612714-5612736 CCAAGAATTCAGGAGCAGCCTGG + Intergenic
1065577041 10:27131647-27131669 TAATTTATGAAGGAGCAGCCTGG - Intronic
1066730596 10:38433546-38433568 CCATGAATTCAAGACCAGCCTGG + Intergenic
1067909636 10:50332833-50332855 CCAGGAATGCAAGACCAGCCTGG - Intronic
1068008863 10:51422498-51422520 CCCTGTGTGGAGGAGCTGCCTGG - Intronic
1068662191 10:59634009-59634031 CCATGTGTTCAAGACCAGCCTGG - Intergenic
1069806028 10:71125594-71125616 CCCTGGAAGCAGGCGCAGCCAGG + Intergenic
1070022565 10:72601210-72601232 CCATGCATTCAAGACCAGCCTGG + Intronic
1072319833 10:94238209-94238231 CCAGGAATTCAAGAGCAGCCTGG + Intronic
1072923223 10:99594217-99594239 CCATATAGGTAGGAACAGCCAGG - Intergenic
1073084443 10:100879322-100879344 CCATGCCTGCATCAGCAGCCTGG + Intergenic
1074016073 10:109535449-109535471 CCAGGAATTCAGGACCAGCCTGG + Intergenic
1074530820 10:114297554-114297576 GCCTGTATGCCGGGGCAGCCTGG + Intronic
1074774322 10:116755756-116755778 CCAGGAATTCAGGACCAGCCTGG + Intergenic
1074908805 10:117888492-117888514 CCAGGAATTCAAGAGCAGCCTGG + Intergenic
1075481493 10:122786389-122786411 CCCTGCAGGCAGTAGCAGCCTGG - Intergenic
1075713543 10:124543210-124543232 CCATACAGGAAGGAGCAGCCAGG - Intronic
1076226324 10:128779138-128779160 CCATGCATGCTGGAACCGCCGGG - Intergenic
1076985001 11:229544-229566 TCAGGAATGCAAGAGCAGCCTGG + Intronic
1077179388 11:1205455-1205477 CCATGTCTCCAGCAGCAGGCTGG + Intergenic
1078089306 11:8254475-8254497 GCATATATGCAGATGCAGCCAGG - Intronic
1078190509 11:9089988-9090010 CCCTGTTTCCAGGAACAGCCCGG + Intronic
1078461706 11:11519731-11519753 CCCTGACTGCAGGAGCAACCAGG + Intronic
1078886669 11:15507245-15507267 CCAAGTATGCAGTAGCATCATGG - Intergenic
1079085582 11:17442673-17442695 GCATGTACGCAGCAGCACCCAGG + Intronic
1079496158 11:21046924-21046946 CCAAGTATTCAAGACCAGCCTGG - Intronic
1080023359 11:27587664-27587686 CCAGGAATTCAGGACCAGCCTGG - Intergenic
1081077310 11:38693286-38693308 CCCTGCAAGCAGGTGCAGCCAGG - Intergenic
1081745236 11:45468248-45468270 ACACGTAGGGAGGAGCAGCCAGG + Intergenic
1081961196 11:47138766-47138788 CCAGGTATTCAAGACCAGCCTGG + Intronic
1083372075 11:62190154-62190176 CCATGTGGGCAGGACCAGCCAGG + Intergenic
1083813266 11:65117276-65117298 CCATGGAGGCAGCAGCCGCCCGG + Exonic
1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG + Intronic
1084266572 11:68008264-68008286 TCATGAATGCAGGAGCAACCTGG - Intergenic
1084623452 11:70290017-70290039 CCAGGTGTTCAAGAGCAGCCTGG + Intronic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1085535615 11:77215484-77215506 CCAAGTGTGCATGAGCAGCTGGG + Intergenic
1086097137 11:83061758-83061780 CCAGGAATTCAAGAGCAGCCTGG - Intronic
1086335512 11:85796977-85796999 CCAGGCATTCAAGAGCAGCCTGG + Intronic
1089356626 11:117858151-117858173 CCATCCATGCTGGAGCATCCTGG + Intronic
1089592505 11:119553042-119553064 CCATGAGTTCAGGACCAGCCTGG + Intergenic
1089811872 11:121138671-121138693 CCATGAAGACAGGAGCAGCAGGG + Intronic
1090011804 11:123051815-123051837 CCAGGAATTCAAGAGCAGCCTGG - Intergenic
1091835927 12:3585789-3585811 CCCAGTGGGCAGGAGCAGCCAGG + Intronic
1092305770 12:7299208-7299230 ACAGATATCCAGGAGCAGCCAGG + Intergenic
1092778575 12:11964973-11964995 CCAGGAATGCAAGACCAGCCTGG - Intergenic
1096293687 12:50364690-50364712 CCATGCATTCAAGACCAGCCTGG + Intronic
1099979310 12:89580764-89580786 TCAGGAATTCAGGAGCAGCCTGG - Intergenic
1100190078 12:92180867-92180889 CCATGAATTCAAGACCAGCCTGG + Intergenic
1100382845 12:94077767-94077789 CCATGAATTCAAGACCAGCCTGG - Intergenic
1101360909 12:104026067-104026089 CCAGGAATGCAAGACCAGCCTGG + Intronic
1101638247 12:106565595-106565617 CCAGGAATTCAAGAGCAGCCTGG + Intronic
1101791428 12:107931132-107931154 CCAGGAATGCAAGACCAGCCTGG - Intergenic
1102248539 12:111370064-111370086 CCAGGTAAGCAGGTGCAGCCAGG + Intergenic
1104655252 12:130569558-130569580 CCAGGGTTGCAGGTGCAGCCTGG + Intronic
1106945073 13:34818449-34818471 CCAGGCATTCAGGACCAGCCTGG - Intergenic
1107870855 13:44745301-44745323 CCAAGTATGCAGGGGCACCTCGG + Intergenic
1107919889 13:45194736-45194758 CTATGTATGCAGGAGCTTTCTGG + Intronic
1108261487 13:48661159-48661181 CCAGGAATTCAAGAGCAGCCTGG - Intronic
1112115766 13:96351519-96351541 CCAGGAATTCAAGAGCAGCCTGG - Intronic
1113065952 13:106374628-106374650 CCATGAGTTCAAGAGCAGCCTGG - Intergenic
1113741615 13:112715570-112715592 CCAGGTAGGGAGGATCAGCCAGG - Intronic
1113960242 13:114122156-114122178 CCCTGAAGGCTGGAGCAGCCTGG - Intronic
1114029543 14:18565711-18565733 TAATTTATGAAGGAGCAGCCTGG + Intergenic
1114207960 14:20590822-20590844 CCAAGGATGGGGGAGCAGCCAGG - Exonic
1115215491 14:31009887-31009909 CCAGGTATTCAAGACCAGCCTGG + Intronic
1117444503 14:55790637-55790659 CCATGTGAGCAAGAGCAGACAGG - Intergenic
1118086161 14:62419763-62419785 ACATGTCTGCAGTAGCATCCAGG - Intergenic
1118726551 14:68633026-68633048 CCATGTGTTCAAGACCAGCCTGG - Intronic
1118727489 14:68639432-68639454 CCTTGCATGCAGGAGGGGCCAGG - Intronic
1118819072 14:69333303-69333325 CCCTGTATGCAGGGACAGCGAGG + Intronic
1118996273 14:70839623-70839645 TAAGGTATGCAGGAGCAGCCGGG + Intergenic
1120117110 14:80633015-80633037 CCAGGAGTGCAAGAGCAGCCTGG + Intronic
1122168300 14:99848751-99848773 CCATGGATTCAAGACCAGCCTGG + Intronic
1122720084 14:103716688-103716710 CAATGTCTGCAGGAGTGGCCTGG - Intronic
1202836375 14_GL000009v2_random:80179-80201 CCCTGTATGCAGGTGTGGCCAGG - Intergenic
1125473405 15:40026243-40026265 CCAGGAATGCAAGACCAGCCTGG + Intronic
1125578527 15:40770452-40770474 ACAGGTGTTCAGGAGCAGCCAGG - Exonic
1126758218 15:51945205-51945227 CCATGAATTCGGGACCAGCCTGG + Intronic
1127327242 15:57907470-57907492 GCATGGATGCTGGAGGAGCCAGG + Intergenic
1128965126 15:72051301-72051323 CCATGGAGGCAGCAGAAGCCAGG + Intronic
1130313106 15:82771782-82771804 CCCTGTGTGCAGGAGGGGCCAGG - Intronic
1130609859 15:85351084-85351106 CCATGAGTTCAGGACCAGCCTGG + Intergenic
1131348808 15:91677359-91677381 TCATGTAAGCAGGACCAGCCAGG + Intergenic
1132088126 15:98924472-98924494 CCATGAATGCAGGAGAAATCTGG - Intronic
1132567247 16:629153-629175 CCGTGAATGCAGGACCATCCAGG - Exonic
1133129085 16:3665058-3665080 CCATGTGTGCAGGGGTGGCCTGG - Exonic
1134032058 16:11000045-11000067 TCAGGTATTCAAGAGCAGCCTGG - Intronic
1134189962 16:12113362-12113384 CCATGTAGTCAGGAGGGGCCAGG - Intronic
1134251282 16:12575787-12575809 CCAGGTATTCAAGACCAGCCTGG + Intergenic
1134755544 16:16664190-16664212 CCATGAATTCAAGACCAGCCTGG - Intergenic
1134990522 16:18694971-18694993 CCATGAATTCAAGACCAGCCTGG + Intergenic
1135501433 16:22999255-22999277 CCAGGAGTGCAAGAGCAGCCTGG + Intergenic
1136276050 16:29180091-29180113 GCATGGATGCCTGAGCAGCCTGG - Intergenic
1136276798 16:29183590-29183612 CCATGTCTCCAGGAGCTGCTGGG - Intergenic
1137251931 16:46747369-46747391 CCATGTGTGAAGGAGCAGAAGGG + Intronic
1137619262 16:49865892-49865914 CCAGGCATTCAAGAGCAGCCTGG + Intergenic
1141249062 16:82338485-82338507 TGATGCATGAAGGAGCAGCCTGG - Intergenic
1141581370 16:85001783-85001805 CCAGGAATTCAAGAGCAGCCTGG - Intronic
1142080425 16:88146153-88146175 GCATGGATGCCTGAGCAGCCTGG - Intergenic
1142081177 16:88149650-88149672 CCATGTCTCCAGGAGCTGCTGGG - Intergenic
1142275642 16:89117521-89117543 CCAGGGAGTCAGGAGCAGCCCGG + Intronic
1143086710 17:4421517-4421539 CCACGTCTGCAGGAGAAGCTGGG - Intergenic
1143462503 17:7112827-7112849 CCATGGAGGCAGGAGGAGCAGGG - Intronic
1144822613 17:18086053-18086075 CCAGGAGTTCAGGAGCAGCCTGG + Intergenic
1144961206 17:19045145-19045167 CCATCTCTGCACGAGCAGCCTGG - Intronic
1144963806 17:19062752-19062774 TCAGGTGTTCAGGAGCAGCCTGG - Intergenic
1144963875 17:19063285-19063307 TCAGGTGTTCAGGAGCAGCCTGG + Intergenic
1144971353 17:19111792-19111814 TCAGGTGTTCAGGAGCAGCCTGG + Intergenic
1144973955 17:19129379-19129401 CCATCTCTGCACGAGCAGCCTGG + Intronic
1144984078 17:19188853-19188875 TCAGGTGTTCAGGAGCAGCCTGG - Intergenic
1144984147 17:19189386-19189408 TCAGGTGTTCAGGAGCAGCCTGG + Intergenic
1145023261 17:19448493-19448515 CCAAGTATTCAAGACCAGCCTGG - Intergenic
1145186407 17:20798490-20798512 CCAGGAGTTCAGGAGCAGCCTGG - Intergenic
1146652107 17:34613388-34613410 CCAGCTAAGCAGGAGCAGCGGGG - Intronic
1146811434 17:35906985-35907007 CCCAGTGAGCAGGAGCAGCCAGG - Intergenic
1147777461 17:42912677-42912699 CCAGGAATTCAAGAGCAGCCTGG - Exonic
1148641108 17:49188352-49188374 CCAGGGATGCAAGACCAGCCTGG + Intergenic
1149000416 17:51751831-51751853 CCATGTATGCAGAAGGGGTCTGG - Intronic
1149308881 17:55374889-55374911 CCAGGTATGCTGGAGCATACTGG - Intergenic
1149949712 17:60972659-60972681 CCATGGATTCAAGACCAGCCTGG - Intronic
1151482338 17:74377735-74377757 CCAGAAATTCAGGAGCAGCCTGG - Intergenic
1152089497 17:78238947-78238969 CCATGTCTGCAGGACCACCTGGG + Intronic
1203174424 17_GL000205v2_random:183672-183694 CCAGGTGTTCAGGACCAGCCTGG - Intergenic
1153006774 18:504219-504241 CCATGAATTCAAGACCAGCCTGG + Intergenic
1153843467 18:9027720-9027742 CCAGGAATTCAGGATCAGCCTGG + Intergenic
1155181092 18:23347632-23347654 CCAAGAATTCAGGACCAGCCTGG - Intronic
1155352475 18:24919982-24920004 CCAGGAATTCAGGACCAGCCTGG + Intergenic
1155412116 18:25557960-25557982 ACATGTCTACAGGAGCTGCCAGG - Intergenic
1155749848 18:29408213-29408235 CCAGGTCTTCAAGAGCAGCCTGG - Intergenic
1156276823 18:35591808-35591830 CTTTGTATGCAGGAGCATACAGG + Intronic
1156526644 18:37774288-37774310 CCATGAGGGCAGGAGCAGCCAGG - Intergenic
1157842345 18:50970162-50970184 CCAGGAATTCAAGAGCAGCCTGG - Intronic
1161204090 19:3031537-3031559 CCAGGAATGCAAGACCAGCCTGG - Intronic
1161384408 19:3983367-3983389 TCATGGAGGGAGGAGCAGCCTGG - Intronic
1162034556 19:7932047-7932069 CCCAGGATGCAGGAGGAGCCTGG - Intronic
1162344802 19:10112977-10112999 ACAAGTCTGCAAGAGCAGCCAGG + Intronic
1162766323 19:12922145-12922167 TCAGGAATTCAGGAGCAGCCTGG - Intergenic
1162877008 19:13627879-13627901 CCAGGTATGAAGGATTAGCCTGG - Intergenic
1163356736 19:16817389-16817411 CCAGGTGTTCAAGAGCAGCCTGG + Exonic
1163374387 19:16921489-16921511 TGCTGTGTGCAGGAGCAGCCTGG - Intronic
1163407163 19:17130027-17130049 CCATGGATTCAGGACCAGCTGGG - Intronic
1163853571 19:19681539-19681561 CCAGGTATTCAAGACCAGCCTGG + Exonic
1165255222 19:34573592-34573614 CCATGTGTGCATGTGCACCCAGG + Intergenic
1165267113 19:34669505-34669527 CCATGTGTGCATGTGCACCCAGG - Intronic
1165661182 19:37581670-37581692 CCAGGAATTCAGGACCAGCCTGG - Intronic
1166863762 19:45824054-45824076 CCATGTCTGGAGGAGCTGCAGGG - Intronic
1167490709 19:49791434-49791456 CCATGAATTCAAGACCAGCCTGG - Intronic
1167559399 19:50216391-50216413 CCAGGAATTCAAGAGCAGCCTGG + Intronic
1167943595 19:52967509-52967531 CCAGGCATTCAGGACCAGCCTGG - Intergenic
1167993749 19:53385474-53385496 CCAGGTATTCAAGACCAGCCTGG + Intronic
1168676871 19:58284963-58284985 CCCTGTCTGAAGGAGCAGCAGGG - Intronic
1202636265 1_KI270706v1_random:47186-47208 CCCTGTATGCAGGTGTGGCCAGG + Intergenic
925222448 2:2153086-2153108 CCAGGTGTTCAGGACCAGCCTGG + Intronic
925570443 2:5305406-5305428 CCAGGTGTTCAAGAGCAGCCTGG + Intergenic
927546634 2:23959955-23959977 CCAAGTTTGCAGGTGCGGCCGGG + Intronic
927709756 2:25317269-25317291 CCATGTGTTCAAGACCAGCCTGG - Intronic
930087282 2:47506757-47506779 ACATGGGTGCAGGAGCAGCCAGG + Intronic
930205466 2:48583296-48583318 CCAGGAATTCAAGAGCAGCCTGG - Intronic
930650577 2:53960576-53960598 CCAAGTAAGCAGGAACAGCATGG + Intronic
930795954 2:55390928-55390950 CCAGGTATTCAAGACCAGCCTGG + Intronic
931063274 2:58555080-58555102 CCATGTGTTCAGGACCAGCCTGG - Intergenic
932241396 2:70159744-70159766 CCATGAATTCAAGACCAGCCTGG - Intronic
932256279 2:70290048-70290070 CCAGGAATTCAGGACCAGCCTGG - Intronic
934624795 2:95836846-95836868 CCAAGGATGCTGGAGCTGCCTGG - Intergenic
935190871 2:100777816-100777838 CCACTTCTGCAGGAGCAGACTGG - Intergenic
935255055 2:101302768-101302790 CCAGGAATTCAGAAGCAGCCGGG + Intronic
935685490 2:105679313-105679335 CCATGTTTCCAGGAGCAGACTGG + Intergenic
935797168 2:106654503-106654525 CCATGTATTCGAGACCAGCCTGG + Intergenic
938070036 2:128303552-128303574 CCATGTATGGAGGAGCATCTGGG - Intronic
941995871 2:171601509-171601531 CCAGGAGTTCAGGAGCAGCCTGG + Intergenic
942180774 2:173378467-173378489 CCAGGAGTTCAGGAGCAGCCTGG + Intergenic
945231606 2:207595776-207595798 CCATGTGTTCAAGAACAGCCTGG - Intronic
946350915 2:219151755-219151777 CCAGGAATGCAAGATCAGCCTGG + Intronic
947678223 2:232004789-232004811 CCAGGAATTCAAGAGCAGCCTGG - Intronic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
948445904 2:238032720-238032742 CCATGAATTCAAGACCAGCCTGG + Intronic
948793753 2:240391903-240391925 GCATGGCTGCAGGGGCAGCCTGG - Intergenic
1168750863 20:280027-280049 CCATGTCTGGAGGAGAAGCAGGG + Intronic
1169144612 20:3244286-3244308 CCAGGTGTTCAGGACCAGCCTGG - Intergenic
1170914443 20:20609206-20609228 CCATGAATTCAAAAGCAGCCTGG - Intronic
1172369537 20:34377652-34377674 CCAGGTATTCAAGACCAGCCTGG + Intronic
1172427800 20:34867501-34867523 CCAGGTATTCAAGACCAGCCTGG + Intronic
1173117925 20:40263586-40263608 CCTTGTATCTAGTAGCAGCCAGG + Intergenic
1173578183 20:44126631-44126653 CCAAGGATGCAGGTGCAGTCAGG + Intronic
1173674346 20:44820940-44820962 CCAGGAGTTCAGGAGCAGCCTGG + Intergenic
1174701285 20:52611559-52611581 CCAGGAATTCAAGAGCAGCCTGG - Intergenic
1174844179 20:53927515-53927537 CCAGGTATTCAAGACCAGCCTGG - Intergenic
1175929144 20:62485429-62485451 CCATGTCTGCAGGAGGAGACAGG - Intergenic
1176332751 21:5564315-5564337 CCAGGTGTTCAGGACCAGCCTGG - Intergenic
1176395006 21:6256637-6256659 CCAGGTGTTCAGGACCAGCCTGG + Intergenic
1176442151 21:6732468-6732490 CCAGGTGTTCAGGACCAGCCTGG - Intergenic
1176466413 21:7059537-7059559 CCAGGTGTTCAGGACCAGCCTGG - Intronic
1176489974 21:7441315-7441337 CCAGGTGTTCAGGACCAGCCTGG - Intergenic
1176897728 21:14402351-14402373 CCATGTACTCAGGTCCAGCCTGG + Intergenic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1180008357 21:45033589-45033611 CCCTGTCTGCCGGAGCAGCTGGG + Intergenic
1180453658 22:15492761-15492783 TAATTTATGAAGGAGCAGCCTGG + Intergenic
1180983351 22:19889989-19890011 CCATGTATGCAGGTGCCGGCTGG + Intronic
1181503160 22:23331358-23331380 TCAGGTATGCAAGACCAGCCCGG - Intergenic
1181516747 22:23418521-23418543 GCATGTATTCAGGGGCAGCAAGG - Intergenic
1181899790 22:26144078-26144100 CCACATATGCAGCAGCAGACTGG - Intergenic
1182041050 22:27239342-27239364 CCAGGAATGCAGGGGCACCCAGG - Intergenic
1182207147 22:28640095-28640117 CCAGGAATTCAGGACCAGCCTGG + Intronic
1182574496 22:31263786-31263808 CCAGGAGTTCAGGAGCAGCCTGG + Intronic
1184234763 22:43177156-43177178 CCAGGTGTGTAGGACCAGCCTGG + Intronic
1184600561 22:45540931-45540953 AGATGAATGCAGGAGAAGCCAGG + Intronic
1184735770 22:46396987-46397009 CCATGTGTCCTGGGGCAGCCTGG - Intronic
950071709 3:10157956-10157978 CCAGGTGTTCAAGAGCAGCCTGG - Intergenic
950111603 3:10422205-10422227 CCATGTGTGCAGGAGCATCTGGG - Intronic
950411863 3:12843749-12843771 CCAGGCATTCAAGAGCAGCCTGG + Intronic
950411882 3:12843883-12843905 CCAGGCATTCAAGAGCAGCCTGG + Intronic
950459548 3:13113061-13113083 CCAGGCATGCAGCAGGAGCCTGG - Intergenic
950530773 3:13551191-13551213 CCATGCATGGAGGACCAGCCTGG - Intronic
950556834 3:13701129-13701151 CCCTGTAGGCAGGAGCACCCAGG - Intergenic
950765647 3:15271166-15271188 CCAGGTATTCAAGACCAGCCTGG + Intronic
951875814 3:27424114-27424136 CCAAGTTTCCAGGAGCAGACTGG + Exonic
952897291 3:38086043-38086065 CCATGTGGCCAGCAGCAGCCTGG + Intronic
953763279 3:45711415-45711437 CCATGAGTTCAGGACCAGCCTGG + Intronic
954224364 3:49172768-49172790 CCATGTCTGCAGGAGGTGGCCGG + Exonic
954385398 3:50241348-50241370 CTTTGTCTGCAGGAGCAGGCAGG + Intronic
954516190 3:51179699-51179721 CCAGGAATTCAGGACCAGCCTGG + Intronic
954593622 3:51805369-51805391 CCAGGTATTCAAGACCAGCCTGG - Intergenic
954611046 3:51944740-51944762 ACATGTGGGCAGGAGCAGCGGGG - Intronic
955369300 3:58337428-58337450 CCATGGATGCAGGAGCTGTCTGG - Intronic
955404763 3:58619208-58619230 CCAGGAATTCAGGACCAGCCTGG - Intronic
955759523 3:62263801-62263823 CCATGAGTGCAAGACCAGCCTGG + Intronic
956276932 3:67512063-67512085 CCAGGAATTCAAGAGCAGCCTGG - Intronic
956758344 3:72412855-72412877 CCATGAATTCAAGAGCAGCCTGG + Intronic
957879938 3:86199514-86199536 ATATCTATGCAGGAGCAGCGTGG - Intergenic
958024328 3:88033001-88033023 CCAGGAATTCAAGAGCAGCCTGG + Intergenic
959536602 3:107493365-107493387 CCATGTGCCCAGGAGAAGCCTGG - Intergenic
959692327 3:109211258-109211280 CCATGAATTCAAGACCAGCCTGG - Intergenic
962316448 3:134362432-134362454 CCATGTAGCCAGAGGCAGCCTGG - Intronic
962539234 3:136361819-136361841 CCATGAATTCAAGACCAGCCTGG - Intronic
963748485 3:149149898-149149920 TTTTGTATGCAGAAGCAGCCTGG + Intronic
963937559 3:151070126-151070148 CCATGCATTCAAGACCAGCCTGG - Intergenic
964041813 3:152269491-152269513 CCAGGGATGCGGGAGCCGCCGGG - Intronic
964215044 3:154270519-154270541 CCATGAATTCAAGACCAGCCTGG - Intergenic
965036132 3:163440167-163440189 CCAGGAGTTCAGGAGCAGCCTGG + Intergenic
966613702 3:181892538-181892560 CCATGAATTCAAGACCAGCCTGG - Intergenic
966742976 3:183251114-183251136 CCATGTATTCTGAAGCAGGCCGG - Intronic
966916876 3:184589300-184589322 CAATGCCTGCATGAGCAGCCAGG - Intronic
967504868 3:190242678-190242700 CCATGTTTGCAGGAGCAAGGTGG - Intergenic
967803495 3:193691002-193691024 CCAGGTGTTCAGGACCAGCCTGG + Intronic
968500720 4:948591-948613 CCAGGCCTGCAGGAGCAGCCGGG - Intronic
968937943 4:3623274-3623296 CCTGGCATGCAGGAGTAGCCTGG - Intergenic
969238935 4:5887370-5887392 CCATGTATGCAGGAGCAGCCCGG - Intronic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
972822038 4:42713073-42713095 TTAAGTATGGAGGAGCAGCCAGG - Intergenic
973946152 4:55958223-55958245 CCATGAATTCAAGACCAGCCTGG + Intronic
973949212 4:55994335-55994357 CCAGGAATTCAAGAGCAGCCTGG + Intronic
974581957 4:63814779-63814801 CCCTGTAAGCAGGAGTGGCCAGG + Intergenic
976283045 4:83344223-83344245 CCAGGAGTTCAGGAGCAGCCTGG + Intergenic
976712148 4:88084158-88084180 CCTTGTGTGCAGGTGTAGCCTGG - Intergenic
977190824 4:93998928-93998950 CCAGGAATTCAGGACCAGCCTGG + Intergenic
978364874 4:107970741-107970763 CCATGGATTCAAGACCAGCCTGG - Intergenic
978754182 4:112285503-112285525 CCAGGTGAGCAGGAGCAGCGGGG + Intronic
979256970 4:118616413-118616435 CCATGAATTCAAGACCAGCCTGG + Intergenic
979331380 4:119424133-119424155 CCATGAATTCAAGACCAGCCTGG - Intergenic
981792268 4:148551908-148551930 CCAGGAATTCAGGACCAGCCTGG + Intergenic
981799749 4:148641650-148641672 CCATGCATGCAGGAACAGAGTGG - Intergenic
983093999 4:163540810-163540832 CCAGGTGTTCAGGACCAGCCTGG + Intronic
985132952 4:186757538-186757560 CCAGGAATGCAAGACCAGCCTGG - Intergenic
986659508 5:10046365-10046387 CCAGGAATTCAGGACCAGCCTGG + Intergenic
987238841 5:15971956-15971978 CCATGTCTGCAGGAGCCCCGAGG - Intergenic
987890786 5:23874641-23874663 CCATGCATTCAAGACCAGCCTGG + Intergenic
988081454 5:26419769-26419791 CCATGAATTCAAGACCAGCCTGG - Intergenic
988501249 5:31785648-31785670 CCAGGAATTCAAGAGCAGCCGGG - Intronic
989822219 5:45807471-45807493 CCAGGTGTCCAAGAGCAGCCTGG - Intergenic
990020577 5:51122074-51122096 CCGTATTTGCAGGAGGAGCCTGG + Intergenic
991009481 5:61868016-61868038 CCATCTTTGCAGGTGCAGCAGGG + Intergenic
991195627 5:63929283-63929305 CAAGGGATGCAGAAGCAGCCAGG + Intergenic
991713946 5:69434252-69434274 CCAGGCATGCAAGACCAGCCTGG + Intronic
992256983 5:74930901-74930923 CCAAGTATTCAAGACCAGCCTGG + Intergenic
992546107 5:77815506-77815528 CCATGGAGGCAGGGGGAGCCCGG + Intronic
993620493 5:90162441-90162463 CCAAGTCTGCAAGAGCAGCGGGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995682174 5:114732043-114732065 CTCTGCAAGCAGGAGCAGCCAGG + Intergenic
996931358 5:128892812-128892834 CCATGAGTTCAAGAGCAGCCGGG - Intronic
997302928 5:132819683-132819705 CCATGTTAGGAGGAGCAGCGGGG + Intergenic
997644753 5:135474186-135474208 CCATTTCTGCAGGAGCCTCCAGG - Intergenic
1002068175 5:176662885-176662907 CCAGGTGTGCAGGTGCAGCCAGG - Intergenic
1002630488 5:180572397-180572419 CCAGGTATTCAAGACCAGCCTGG - Intronic
1003250189 6:4421271-4421293 CCAGATGTTCAGGAGCAGCCTGG + Intergenic
1004265618 6:14146094-14146116 ACATGTGTGCAGAAGAAGCCTGG + Intergenic
1004607735 6:17209577-17209599 CCAGGAATTCAAGAGCAGCCTGG - Intergenic
1005396620 6:25388890-25388912 CCATGAATTCAAGACCAGCCTGG - Intronic
1006455020 6:34126715-34126737 CCATGTCTGCAGCAACAGCTGGG - Intronic
1006753891 6:36397788-36397810 CCAGGAATCCAGGACCAGCCTGG + Intronic
1006859196 6:37158691-37158713 CCAGGAGTTCAGGAGCAGCCTGG - Intergenic
1008141132 6:47833630-47833652 CCAGGTATTCAAGACCAGCCTGG + Intergenic
1008357388 6:50570635-50570657 CCAGGTATTCAAGACCAGCCTGG + Intergenic
1008383033 6:50855347-50855369 CCAAGACTGCAGGACCAGCCTGG + Intergenic
1008740412 6:54600224-54600246 CCAGGAATTCAGGACCAGCCTGG - Intergenic
1008914220 6:56769604-56769626 CCAGGAATTCAGGACCAGCCTGG + Intronic
1011129498 6:84038702-84038724 CCAGGAATGCAAGACCAGCCTGG - Intronic
1011707280 6:90013991-90014013 CCAGGAATTCAAGAGCAGCCTGG - Intronic
1013279781 6:108624989-108625011 CCATGAATTCAAGACCAGCCTGG - Intronic
1013551580 6:111212581-111212603 CCAGGAATGCAAGACCAGCCTGG + Intronic
1015139494 6:129913436-129913458 CCAGGTATTCAAGACCAGCCTGG + Intergenic
1015437272 6:133203624-133203646 CCAAGAGTGCAGGACCAGCCTGG - Intergenic
1015673983 6:135724249-135724271 CCTTGTATCCAGAAGCAACCAGG + Intergenic
1015998978 6:139023675-139023697 CCAGGAATTCAGGAGCAGCCTGG - Intergenic
1016623583 6:146140476-146140498 CCATGAATTCAAGACCAGCCTGG - Intronic
1018004321 6:159606209-159606231 CCAGGCATTCAGGACCAGCCTGG - Intergenic
1018013213 6:159690384-159690406 CCAGGAATTCAAGAGCAGCCTGG + Intronic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1019951685 7:4378317-4378339 TCATGAATTCAGGAGGAGCCTGG + Intergenic
1020173504 7:5864128-5864150 CCATGAGTGCAAGACCAGCCTGG + Intergenic
1020777550 7:12473578-12473600 CCAGGAATTCAAGAGCAGCCTGG - Intergenic
1022419596 7:30207835-30207857 CCAGGAATTCAAGAGCAGCCTGG + Intergenic
1022664325 7:32396267-32396289 CCAGGAATTCAAGAGCAGCCAGG + Intergenic
1023233277 7:38056529-38056551 CAATGTATGCAGGAAAAGCATGG + Intergenic
1023279513 7:38555193-38555215 CCAGGTATTCAAGACCAGCCTGG + Intronic
1023617795 7:42038194-42038216 CCAGGAGTGCAGGAGCAGCCAGG + Intronic
1023904205 7:44510372-44510394 CCAAGTATTCAAGACCAGCCTGG + Intergenic
1024071895 7:45793486-45793508 CCATGAATTCAAGACCAGCCTGG + Intergenic
1025020627 7:55476723-55476745 CCATGGCTGGAGGAGCAGCTGGG - Intronic
1025133692 7:56392791-56392813 CCATGAATTCAAGACCAGCCTGG - Intergenic
1025192595 7:56907421-56907443 CCAGGCATTCAGGACCAGCCTGG - Intergenic
1025277706 7:57597907-57597929 CCAAGTATTCAAGACCAGCCTGG - Intergenic
1025679350 7:63669499-63669521 CCAGGCATTCAGGACCAGCCTGG + Intergenic
1026331897 7:69359420-69359442 CCATGAATTCAAGACCAGCCTGG + Intergenic
1026485215 7:70812361-70812383 CCAGGTGTTCAGGACCAGCCTGG - Intergenic
1027360886 7:77408487-77408509 CCAGGAATTCAAGAGCAGCCTGG + Intronic
1029565202 7:101332335-101332357 CCAGGTGTTCAGGACCAGCCTGG + Intergenic
1029644745 7:101846920-101846942 CCAGGAATTCAAGAGCAGCCTGG + Intronic
1029782873 7:102752633-102752655 CCATGAGTGCAAGACCAGCCTGG - Intronic
1030104668 7:105977024-105977046 CCAGGAATGCAAGTGCAGCCTGG - Intronic
1030454909 7:109760855-109760877 CCATGCAAGCAGGTGCAGCCAGG + Intergenic
1032049279 7:128637193-128637215 CCATGAATTCAAGACCAGCCTGG + Intergenic
1032070350 7:128801719-128801741 CCAGGCATTCATGAGCAGCCTGG + Intronic
1032958011 7:136995551-136995573 CCAGGAATTCAGGACCAGCCTGG + Intronic
1032991682 7:137401320-137401342 CCAGGAATTCAAGAGCAGCCTGG + Intronic
1034117333 7:148594909-148594931 TCATGTAAGCAGGAGCGGCTGGG - Intronic
1035066140 7:156106215-156106237 GCCTGTCTGCAGGCGCAGCCCGG - Intergenic
1035397340 7:158543889-158543911 CCTTGTGGGCAGGGGCAGCCTGG - Intronic
1036096698 8:5732853-5732875 CCATGGAGGCAGGAACAGGCAGG - Intergenic
1037538103 8:19846210-19846232 CCAGGAATTCAGGACCAGCCTGG + Intronic
1037858085 8:22385785-22385807 CCAGGAGTTCAGGAGCAGCCTGG + Intronic
1038170669 8:25128701-25128723 CCCTGTAAGCAGGCACAGCCAGG - Intergenic
1039052836 8:33510584-33510606 CCAGGAATTCAGGACCAGCCTGG - Intronic
1042273872 8:66982990-66983012 CCAGGAATACAAGAGCAGCCTGG - Intronic
1042813491 8:72852023-72852045 CCAGGAATTCAGGACCAGCCTGG + Intronic
1043782950 8:84360080-84360102 CCATGAATTCAAGACCAGCCTGG - Intronic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1044922961 8:97185357-97185379 CCTGGAATGCAGCAGCAGCCAGG - Intergenic
1045810461 8:106215069-106215091 CCAAGTATTCAAGACCAGCCTGG + Intergenic
1049297959 8:141853269-141853291 CCATGCATGCAGGCACTGCCTGG - Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1049492293 8:142911848-142911870 CCATTTGTGCAGGAGCTGGCTGG + Exonic
1049736825 8:144212292-144212314 CCAGGAATCCAGGACCAGCCTGG - Intronic
1049971652 9:826794-826816 CCATGCGGGCAGGGGCAGCCTGG + Intergenic
1051144397 9:14010964-14010986 CCAGGGATTCAGGAGCAGCCTGG - Intergenic
1051628092 9:19117366-19117388 CCAGGAATTCAGGACCAGCCTGG - Intronic
1053174123 9:35909998-35910020 CTATGGATGCAGGAGGAGCCCGG - Intergenic
1053197519 9:36131429-36131451 CCAGGAATTCAAGAGCAGCCTGG - Intergenic
1054453225 9:65414433-65414455 CCTGGCATGCAGGAGTAGCCTGG + Intergenic
1054945642 9:70793242-70793264 CCAGGAATTCAGGATCAGCCTGG + Intronic
1054965865 9:71026309-71026331 CACTGCATGCAGGTGCAGCCAGG - Intronic
1056517628 9:87370551-87370573 CCATGTTGGCAGGAGCACCACGG + Intergenic
1056761846 9:89421073-89421095 CCGTGTGTGCAGGAGGAGGCTGG - Intronic
1057248736 9:93481896-93481918 CCATGAATGAGGGTGCAGCCTGG - Intronic
1058980857 9:110168884-110168906 CCATGTAGGCTGCACCAGCCTGG - Exonic
1059161196 9:112036603-112036625 CCATGTGTTCAAGACCAGCCTGG - Intergenic
1059791949 9:117649675-117649697 CCAGGAATTCAGAAGCAGCCTGG + Intergenic
1060625362 9:125107554-125107576 CCAGGAATTCAAGAGCAGCCTGG + Intronic
1060730024 9:126031204-126031226 CCATGCGTGCAGGGGAAGCCAGG + Intergenic
1061306680 9:129736480-129736502 CCATGCATGCAGCTCCAGCCTGG - Intergenic
1061344645 9:130013187-130013209 CCAGGTATTCAAGACCAGCCTGG - Intronic
1061403366 9:130380575-130380597 CCAGGTATTCAAGACCAGCCTGG + Intronic
1185955153 X:4481203-4481225 CCAGGAATTCAAGAGCAGCCTGG + Intergenic
1186453244 X:9690687-9690709 TTATTTATGCAGAAGCAGCCAGG + Intronic
1186482711 X:9908176-9908198 CCAAGAATGCAGGAGCACGCAGG + Intronic
1186878717 X:13842667-13842689 CCAGGAGTTCAGGAGCAGCCTGG + Intronic
1187381027 X:18802279-18802301 CCAGGAATTCAAGAGCAGCCTGG - Intronic
1188996870 X:36897452-36897474 CACTGTAAGCAGGTGCAGCCAGG + Intergenic
1189177389 X:38971606-38971628 CCATGTCTTCTGCAGCAGCCTGG - Intergenic
1190792537 X:53713395-53713417 CCAGGAGTGCAAGAGCAGCCTGG - Intergenic
1190883811 X:54512735-54512757 CCATGAGTTCAAGAGCAGCCTGG + Intergenic
1191971837 X:66825390-66825412 CCATGAGTTCAAGAGCAGCCTGG + Intergenic
1192836893 X:74809406-74809428 CTATGAGTGCAGGATCAGCCAGG - Intronic
1194361280 X:92953540-92953562 CCATGAATGCAAGACCAGTCTGG + Intergenic
1195061514 X:101199708-101199730 CCAAGAGTGCAAGAGCAGCCTGG - Intergenic
1197750276 X:129959321-129959343 CCATGTGTGCAGGTTCAGGCAGG - Intergenic
1198763949 X:140062263-140062285 CCAGGAGTTCAGGAGCAGCCTGG + Intergenic
1200521090 Y:4210537-4210559 CCCTGAATGAAGGAGAAGCCAGG + Intergenic
1200669476 Y:6069386-6069408 CCATGAATGCAAGACCAGTCTGG + Intergenic
1200768599 Y:7102952-7102974 CCAGAAATGCAGGACCAGCCTGG + Intergenic
1201306492 Y:12555148-12555170 CCAAGAATGCAGGAGCACGCAGG + Intergenic
1201706699 Y:16945437-16945459 CCAGGTATTTGGGAGCAGCCTGG - Intergenic