ID: 969240357

View in Genome Browser
Species Human (GRCh38)
Location 4:5893073-5893095
Sequence CCGGGCGCGACTGCGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969240349_969240357 0 Left 969240349 4:5893050-5893072 CCTCGGTGCGGGCCTGCGGCGGC 0: 1
1: 0
2: 2
3: 5
4: 184
Right 969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 73
969240341_969240357 19 Left 969240341 4:5893031-5893053 CCGTGCGCCGCGCTCCGCGCCTC 0: 1
1: 1
2: 3
3: 22
4: 271
Right 969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 73
969240346_969240357 5 Left 969240346 4:5893045-5893067 CCGCGCCTCGGTGCGGGCCTGCG 0: 1
1: 0
2: 1
3: 8
4: 105
Right 969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 73
969240340_969240357 22 Left 969240340 4:5893028-5893050 CCGCCGTGCGCCGCGCTCCGCGC 0: 1
1: 0
2: 2
3: 34
4: 239
Right 969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 73
969240343_969240357 12 Left 969240343 4:5893038-5893060 CCGCGCTCCGCGCCTCGGTGCGG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 73
969240339_969240357 30 Left 969240339 4:5893020-5893042 CCTGGGCACCGCCGTGCGCCGCG 0: 1
1: 0
2: 3
3: 11
4: 161
Right 969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969240357 Original CRISPR CCGGGCGCGACTGCGGCCCA GGG Intergenic
900088752 1:910215-910237 CCTGGCGCCTCTGCTGCCCACGG + Intergenic
900291631 1:1926188-1926210 CCTGGCCACACTGCGGCCCAAGG - Intronic
901021985 1:6260493-6260515 CCTGGCGGGACTGCGGCCCCCGG + Intronic
906263165 1:44407926-44407948 CCCCGCGCGGCTGCGGACCAGGG + Intronic
917853134 1:179082180-179082202 CCGGGCGCGCCTGAGCCCCGCGG + Exonic
918040827 1:180912994-180913016 CCGGGAGGGAGTGCGGCCCGTGG + Intergenic
920665479 1:207959753-207959775 CCTCGCGCGACTGCAGCCCTGGG - Intergenic
1067091293 10:43266877-43266899 CGGGGCCCGACTGCGGCGCGAGG - Intronic
1067113962 10:43420587-43420609 CCGGGCGCGCCTGCTGCGCGGGG + Intergenic
1071498087 10:86182285-86182307 CAGGGGGCGACTCCGGGCCACGG + Intronic
1076374334 10:129973157-129973179 CTGGGCGCAGCTGCGGCCCCGGG - Intergenic
1076509558 10:131002747-131002769 CCAGGAGCGACTCCGGCACATGG - Intergenic
1084266713 11:68008770-68008792 CCGGGAGCTACGGAGGCCCAGGG + Intronic
1092233729 12:6792642-6792664 CCGAGCACGCCTGCAGCCCAGGG - Intronic
1098074685 12:66716366-66716388 CCAGGCCCCACTGCAGCCCAGGG + Intronic
1118925693 14:70188496-70188518 CCGGACGCGGCTGCGGCCGGCGG - Exonic
1122645193 14:103189329-103189351 CCTGGCGGGACTGGGTCCCAGGG + Intergenic
1127426683 15:58865140-58865162 CCGGGACCGGCTGCGGCCCGAGG + Intergenic
1132697639 16:1209060-1209082 CCAGGCGCCACTGGGGCCCCAGG - Exonic
1132884749 16:2177746-2177768 CCTGGCGTGGCTGCGTCCCAGGG - Exonic
1142474617 17:181515-181537 CCCGGCGCGACCCCGGCCCGGGG + Exonic
1147739052 17:42659965-42659987 CCGGGGGCGGCAGTGGCCCAAGG + Intronic
1149491257 17:57086205-57086227 CCGGCCCCGCCTGCGGCCCAGGG + Intronic
1150002633 17:61451544-61451566 CCTGGGGAAACTGCGGCCCAGGG - Intergenic
1150134786 17:62689781-62689803 CCGGGCAAGGCTGGGGCCCAGGG - Intronic
1153457172 18:5295111-5295133 CAGGGAGGGACTGCGGCCCGCGG + Intronic
1154303861 18:13217377-13217399 CTGGGCGGGAGTGCGGCCCCGGG + Intergenic
1154992787 18:21612219-21612241 AGGAGCGCGACTGCGGCCCCTGG - Intergenic
1160729162 19:632910-632932 CCGGTGGCGTCTGCGGCCCCAGG - Exonic
1160846735 19:1169321-1169343 CAGGGCACGAGTGCGGCCCCAGG + Intronic
1161435042 19:4258152-4258174 TCGGGGGCCACTGCGGGCCACGG - Intronic
1161578069 19:5065785-5065807 CCGGGGGCTTCTGGGGCCCATGG + Intronic
1162717631 19:12643899-12643921 ACGGGCGGGGCGGCGGCCCATGG + Exonic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1166634954 19:44442993-44443015 CAGAGCGCGACTGCTTCCCATGG + Exonic
1167072942 19:47231097-47231119 GCGGACGCGCCTGCGGCCCGGGG - Intronic
928181859 2:29073607-29073629 CCGGGAGCTGCTGCAGCCCATGG - Exonic
931728162 2:65130466-65130488 CCGGGCGAGTCAGCGCCCCACGG + Intergenic
936433180 2:112482008-112482030 CCGGGGGCGGCGGCGGCGCAGGG - Intergenic
942278126 2:174337051-174337073 CGGGGCGAGCCTGCGGCGCAAGG + Exonic
948757413 2:240167596-240167618 CCAGGGGCAACTGAGGCCCATGG - Intergenic
948824699 2:240568542-240568564 CCCGGCGCGGCCGCCGCCCATGG + Intronic
1175517204 20:59577337-59577359 CCGGGCGAGGCTGCGGCTCCGGG + Intergenic
1176159461 20:63641079-63641101 CCGGGCGCGGCTGGGTCCCCCGG - Exonic
1178513903 21:33230155-33230177 CCGGGCGCGGCTGGGGCCCGAGG + Exonic
1180960676 22:19761024-19761046 CCGGGGGCGGCGGCGGCGCACGG - Exonic
1181778969 22:25179050-25179072 CCGGGCGCGGCTGGGTCCCCCGG - Intronic
1181965969 22:26657138-26657160 CTGCGCGCGACCGCGGACCAGGG - Intergenic
1185274057 22:49942384-49942406 CCAGGCGCCACTGTGGGCCATGG + Intergenic
953905767 3:46867618-46867640 CCTGCGGAGACTGCGGCCCAGGG - Intronic
954397580 3:50301037-50301059 CTGGGGGAGAGTGCGGCCCAGGG - Exonic
959984858 3:112561529-112561551 CCGGCCGCTACTCCGGCCCCAGG - Exonic
960072043 3:113441567-113441589 CCGGCCGCGCATGCGCCCCACGG - Intronic
961501396 3:127338356-127338378 CGGGGCGCGACTCGGGCCCATGG - Intergenic
968915673 4:3496150-3496172 GCGGGAGGGACAGCGGCCCACGG - Intronic
969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG + Intergenic
969602309 4:8183454-8183476 CCGGGCTGGCCTGAGGCCCATGG + Intronic
976184542 4:82430751-82430773 CCGGCTGCGGCTGCGGCCCCCGG - Exonic
986858948 5:11904233-11904255 CCGGGCGCCGCGGCGGCCCCAGG - Intergenic
992105888 5:73448590-73448612 CCGGGCGCGAGCGGAGCCCAGGG - Intergenic
992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG + Exonic
999247412 5:150162471-150162493 CAGGGGGAGACTGAGGCCCAGGG + Intergenic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1003862835 6:10337701-10337723 TCGGGCGCAACTGGAGCCCATGG - Intergenic
1005578416 6:27211242-27211264 ACGGGCGCGGCGGCGGCCCATGG - Intergenic
1017935289 6:158999849-158999871 CCGGGAAGGACTGCGGCACAAGG + Exonic
1019354345 7:570987-571009 CAGGGCGTGTCTGCGGCCCACGG + Intronic
1027978360 7:85186431-85186453 CGGGGTGGGACTGCGCCCCAGGG + Intronic
1033274172 7:139958677-139958699 CAGGACGCGGCTGCTGCCCAAGG - Intronic
1034218013 7:149422566-149422588 CAGGGCGCGCCGGCGGCCCACGG - Intergenic
1034467506 7:151238548-151238570 CCCTGCGAGACTGCAGCCCACGG + Exonic
1039443541 8:37612330-37612352 GAGGGCGAGACTGTGGCCCATGG + Intergenic
1041281117 8:56211648-56211670 CCGACCGCCCCTGCGGCCCAGGG + Intergenic
1043284914 8:78516406-78516428 CGCGGCGGGACTGCGGCCCGTGG + Exonic
1049216667 8:141411448-141411470 CACGGCGCCACTGAGGCCCAGGG - Intronic
1049654159 8:143790437-143790459 CCTGTCGCTGCTGCGGCCCACGG + Intergenic
1049762464 8:144337467-144337489 GCGGGAGCCACTGCGGCACAGGG - Intergenic
1049879529 8:145052473-145052495 CCGGTGGCGACTGCGGCGCATGG + Exonic
1058908186 9:109498148-109498170 CCGAGCGCGACCCCGGCCCCCGG + Intronic
1061093344 9:128439389-128439411 CAGGGCCTGACTGCGGCCCATGG - Intergenic
1187915382 X:24149275-24149297 CGGGGGGCGGCCGCGGCCCACGG + Intronic
1198005629 X:132489837-132489859 ACGGGCGGGAATGCGGCCAAGGG + Intronic
1200222579 X:154398518-154398540 ACGGGCGGGGCGGCGGCCCATGG - Exonic