ID: 969241914

View in Genome Browser
Species Human (GRCh38)
Location 4:5904535-5904557
Sequence CATTTTACAGATAAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969241905_969241914 18 Left 969241905 4:5904494-5904516 CCCTCAGTAGGAACTCAGCCACT 0: 1
1: 0
2: 0
3: 16
4: 150
Right 969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG No data
969241908_969241914 0 Left 969241908 4:5904512-5904534 CCACTGGAAGACTGTGCCACACC 0: 1
1: 0
2: 0
3: 15
4: 118
Right 969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG No data
969241902_969241914 29 Left 969241902 4:5904483-5904505 CCAGAGCCTGCCCCTCAGTAGGA 0: 1
1: 0
2: 4
3: 21
4: 208
Right 969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG No data
969241904_969241914 19 Left 969241904 4:5904493-5904515 CCCCTCAGTAGGAACTCAGCCAC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG No data
969241906_969241914 17 Left 969241906 4:5904495-5904517 CCTCAGTAGGAACTCAGCCACTG 0: 1
1: 0
2: 1
3: 14
4: 219
Right 969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG No data
969241903_969241914 23 Left 969241903 4:5904489-5904511 CCTGCCCCTCAGTAGGAACTCAG 0: 1
1: 0
2: 1
3: 25
4: 314
Right 969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969241914 Original CRISPR CATTTTACAGATAAGGAGCT GGG Intronic
No off target data available for this crispr