ID: 969242133

View in Genome Browser
Species Human (GRCh38)
Location 4:5906209-5906231
Sequence ATGTTGGCATGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969242129_969242133 2 Left 969242129 4:5906184-5906206 CCTGTGACGGTTGGCAGCATGGC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969242133 Original CRISPR ATGTTGGCATGGAGAGAAGT GGG Intronic
900433286 1:2612821-2612843 AGGGTGGGATGGAGAGAAGAGGG + Intronic
900555639 1:3279050-3279072 AAGTTGACATGGAGAGAAACTGG - Intronic
901667226 1:10833107-10833129 GTGTTGGCTTGGAGAGAGGCTGG - Intergenic
901735505 1:11309749-11309771 ATGGTGGCAAGGAGAAAAATGGG - Intergenic
905005868 1:34709933-34709955 ATGTTGACAGGGAGAGGGGTAGG + Intergenic
905970245 1:42136540-42136562 AGGCTGGCAGGGTGAGAAGTTGG - Intergenic
906829227 1:49014114-49014136 ATGTGCACATGGAGAGAAGGGGG - Intronic
907193800 1:52669962-52669984 ATGATGGCATGGAGGAATGTTGG - Intergenic
909077222 1:71064450-71064472 ATGTCTACAAGGAGAGAAGTGGG - Exonic
909503159 1:76357970-76357992 ATGTTGGCAGGGAGGCAGGTAGG - Intronic
910286425 1:85559874-85559896 TTGTCCACATGGAGAGAAGTAGG + Intronic
912498991 1:110109436-110109458 ATGGTTGCATGGAGGGAGGTGGG + Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
916752391 1:167734884-167734906 ATATTGGAATGGAGAAATGTGGG - Intronic
917485156 1:175448861-175448883 TTTTTGGCATGGAGGGAAGCAGG - Intronic
919363442 1:196624978-196625000 TTGTTGGGATAGAAAGAAGTTGG + Intergenic
920143573 1:203839076-203839098 ATGCTGGCGTGGAGATGAGTTGG + Intronic
920320261 1:205116155-205116177 ATGTTTGCCTGAATAGAAGTTGG - Intronic
920443388 1:205997128-205997150 GGGTTGGCATGGTGAGAAATGGG + Intronic
921759153 1:218892109-218892131 CTATTTGCATGGACAGAAGTTGG - Intergenic
921848941 1:219913559-219913581 AACTTGGCATGGAGATCAGTGGG - Intronic
921850198 1:219926389-219926411 AAGTTGGAAGGGAGAGATGTTGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923230481 1:231981929-231981951 CAGTTGGTATGTAGAGAAGTGGG + Intronic
923437967 1:233986293-233986315 AACTTGGGGTGGAGAGAAGTTGG - Intronic
1062770595 10:97422-97444 AAATTGGTATTGAGAGAAGTGGG - Intergenic
1065364128 10:24918237-24918259 GTAATGGCATGGAGATAAGTTGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065846887 10:29751907-29751929 ACGTGGGCATGGAGAATAGTGGG + Intergenic
1066341184 10:34535194-34535216 ATATTGGCATGGGTAGAAGCAGG + Intronic
1068559716 10:58500074-58500096 ATGTTGGGATGGAGAGAATTAGG - Intergenic
1069789663 10:71011573-71011595 TTGTTGTCATGGTGAGAACTGGG + Intergenic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1071443169 10:85721955-85721977 ATGTTACCATTGAGAAAAGTGGG + Intronic
1071998236 10:91167975-91167997 ATGTTGGCAAGGATTGAAATAGG + Intronic
1072205802 10:93204498-93204520 TTGTTGCCGTGGAGAGAAGCAGG - Intergenic
1073037690 10:100575723-100575745 CTGATGGCATGGAGAGAGGGCGG - Intergenic
1073768662 10:106710757-106710779 AGATTAGCATGGTGAGAAGTGGG - Intronic
1075539241 10:123298536-123298558 ATATTGACATGGGGAGCAGTTGG - Intergenic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1081626512 11:44659162-44659184 ATAATGGGATGGAGAGAGGTAGG + Intergenic
1081792762 11:45800418-45800440 ATGGAGGAATGGACAGAAGTTGG - Intergenic
1083503765 11:63136411-63136433 ATGTTGTCATGGAGAAGAATTGG - Intronic
1087008088 11:93488603-93488625 GTGTTGCCATTGAGAGAGGTGGG + Intronic
1087350651 11:97027676-97027698 ATGCAGGAAAGGAGAGAAGTAGG - Intergenic
1087823185 11:102734197-102734219 ATGCAGGCATGGAAATAAGTTGG - Intergenic
1088406476 11:109485405-109485427 ATGTTGGGATAGAGAGTAGAAGG + Intergenic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1088695171 11:112360274-112360296 ATGATGGGATGGAGAGAACATGG + Intergenic
1089082456 11:115788201-115788223 ATGTTGGCAAGGGGAGCATTTGG - Intergenic
1089216759 11:116838792-116838814 ATGGTGGCATGGGGAGAGGCTGG - Intergenic
1089561920 11:119347415-119347437 AGTTTGGCAGGGAGGGAAGTGGG + Intergenic
1090925042 11:131242181-131242203 ATGTTGGCAGGAAGAGAAAGAGG - Intergenic
1093939965 12:25042331-25042353 ATGTTGGCAGGGAGAATTGTTGG + Intronic
1094475972 12:30840813-30840835 TTGTTGCCATGGAAAGGAGTGGG + Intergenic
1095934200 12:47659053-47659075 TTGATGGCATGGACAGTAGTAGG - Intergenic
1096593746 12:52680347-52680369 ATGTTGACTTAGAGAAAAGTAGG + Exonic
1098583471 12:72129615-72129637 ATGTTGGGAAAGAGAGAAGCAGG + Intronic
1098749210 12:74273881-74273903 ATGTTGGCAAGAATAGAAGCAGG + Intergenic
1100551996 12:95654663-95654685 ATGTTGGGATGACGAGATGTTGG + Intergenic
1100552010 12:95654727-95654749 ATGTTGGGATGACGAGATGTTGG + Intergenic
1101087959 12:101255418-101255440 ATGTTGTCAGGGAAATAAGTTGG + Intergenic
1101408718 12:104452203-104452225 ATAATGGCAGGGAGAGAAGGGGG - Intergenic
1101498597 12:105279877-105279899 AGGTAAGCATGCAGAGAAGTTGG - Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102287455 12:111670350-111670372 ATGTTGGATGGGAGAGAAGAAGG - Intronic
1104388579 12:128372694-128372716 ATGTGGGCTGAGAGAGAAGTTGG + Intronic
1104672293 12:130689110-130689132 GTGTTGGCATGGAGGGGTGTGGG - Intronic
1106670428 13:31899020-31899042 AGGATGGGATGGAGAGAGGTAGG - Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1109043052 13:57366523-57366545 ATGGTGGCATGATGAGAACTGGG - Intergenic
1109580473 13:64325544-64325566 ATTTTGGAATGGAGTGGAGTGGG + Intergenic
1109725561 13:66336312-66336334 ATGTTTGGATGGTCAGAAGTGGG + Intronic
1110039842 13:70739948-70739970 ATTTTGGCATTGCTAGAAGTTGG + Intergenic
1110441553 13:75532115-75532137 CTTTTGGGGTGGAGAGAAGTGGG + Intronic
1110445490 13:75575225-75575247 ACGGTGGGATGGAGAAAAGTAGG - Intronic
1112095503 13:96127878-96127900 ATATTAGAATGTAGAGAAGTAGG + Intronic
1112295969 13:98187471-98187493 ATGTTGGCAGGTGGAGATGTGGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113616826 13:111686147-111686169 ATCGAGGCATGGAGAGGAGTCGG + Intergenic
1113622356 13:111771418-111771440 ATCGAGGCATGGAGAGGAGTCGG + Intergenic
1113964183 13:114143128-114143150 TGGTTGGCTTGGAGAGCAGTGGG - Intergenic
1115091714 14:29584932-29584954 AATTTGGGGTGGAGAGAAGTCGG - Intronic
1115713310 14:36074230-36074252 ATGCTGTTATGAAGAGAAGTGGG + Intergenic
1116402793 14:44529350-44529372 ATGTTGAAATTCAGAGAAGTGGG - Intergenic
1116568721 14:46487403-46487425 TTGTAGGCTAGGAGAGAAGTCGG - Intergenic
1116639631 14:47444496-47444518 ATGGTGGCATGGAAAGATGGTGG + Intronic
1116823975 14:49653144-49653166 AGGTTGGGATGGTGATAAGTAGG + Intronic
1116920135 14:50563336-50563358 ATGTTTTCATGGAGAGAATGGGG + Intronic
1117374539 14:55108530-55108552 ATGTTAGCCTGGAGTGAAATTGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1118256182 14:64208135-64208157 GTGGTGGCTTGGAGAGAGGTGGG - Intronic
1118291936 14:64534802-64534824 ATGTTGGCCTGAAGAAAAGATGG - Intergenic
1118929118 14:70223763-70223785 CTGTTTGCATGGGGAGGAGTCGG - Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1123448525 15:20346076-20346098 ATGGTGGCATGGAGAGCTGGAGG - Intergenic
1125486671 15:40116014-40116036 ATGTAGTCAAGGATAGAAGTAGG - Intergenic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1127374325 15:58369185-58369207 AAGGAGGCGTGGAGAGAAGTGGG - Intronic
1127897055 15:63310472-63310494 AGGTTGGAAAGGAGAGAAGAAGG + Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128854842 15:71001313-71001335 TTGTTGGCAGTGAGAGAAGTAGG + Intronic
1129084096 15:73070032-73070054 ATGTTGGCATGGGGAAAACAAGG + Intronic
1130020942 15:80231189-80231211 ATGTGAACCTGGAGAGAAGTAGG - Intergenic
1130603597 15:85295349-85295371 ATGTTGGCATGGAGTGGGGTGGG - Intergenic
1130849009 15:87775808-87775830 ATGTTGTCATGGAGAAGAATTGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131285141 15:91050700-91050722 ATGTTGGCATGGGGTGGGGTGGG + Intergenic
1133702548 16:8322595-8322617 ATGAAGGGATGGAGAGAAGGTGG - Intergenic
1134634813 16:15784242-15784264 ATGATGGCAGGGAGAGAAGAGGG + Intronic
1136291881 16:29278342-29278364 ATCTTGGCAGTGAGAAAAGTTGG - Intergenic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1137739468 16:50753492-50753514 ATGGAGGCAAGGAGAGAAGCTGG - Intronic
1137882582 16:52067407-52067429 ATGGTGGGATGCAGAGTAGTAGG - Intronic
1140957478 16:79878671-79878693 ATGTTACAATGGGGAGAAGTGGG - Intergenic
1142097773 16:88252302-88252324 ATCTTGGCAGTGAGAAAAGTTGG - Intergenic
1142419382 16:89961100-89961122 GTGGTGGCAGGGAGAGAAGAGGG + Intronic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143277853 17:5726852-5726874 ATGTTGTCATGGAGAAGAGTTGG - Intergenic
1146147115 17:30429367-30429389 ACCTTGGCATGGTGAGAGGTAGG + Intronic
1146374896 17:32287427-32287449 TTGTAGGCATGGAGAGAATGGGG + Intronic
1146645027 17:34571565-34571587 AGGAGGCCATGGAGAGAAGTTGG + Intergenic
1146679565 17:34797315-34797337 CTGTTGCCATGGAGAGATGTGGG - Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147979036 17:44263428-44263450 ATGGGGTCAGGGAGAGAAGTAGG - Intronic
1148236329 17:45971676-45971698 GTGTTGGCAGGGAGGGAGGTGGG + Intronic
1150021647 17:61621203-61621225 ATGGTGGCAGGGAGGGAAATGGG - Intergenic
1150645712 17:66976389-66976411 ATGGAGGGATGGAAAGAAGTTGG - Intronic
1153859364 18:9185334-9185356 CTTTTGGGATGAAGAGAAGTTGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156189701 18:34704147-34704169 ATAATGGGATGGAGAGAACTGGG - Intronic
1156861110 18:41837399-41837421 AGGCTGGCCTGGAGAGAAGACGG - Intergenic
1158525009 18:58205519-58205541 TGGTTGGCAGGGAGAGAAGGAGG + Intronic
1160613083 18:80104259-80104281 TTGTTGGCATGGAGAGCTGGAGG - Intergenic
1166794582 19:45418930-45418952 ATGTTGGCAAGGAGAGGGGAGGG - Intronic
927559672 2:24061089-24061111 ATGCTGGCAAGGAGAGGGGTGGG - Intronic
928076733 2:28272031-28272053 ATGTTGGCTGGTAGAGAATTGGG + Intronic
928114901 2:28539696-28539718 GTGCTGGAAAGGAGAGAAGTGGG + Intronic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
930291787 2:49503236-49503258 ATGTTATCATTGAGAGAAGCAGG - Intergenic
930926694 2:56826832-56826854 ATGTGGGCATGGAGAAATGTTGG + Intergenic
932047541 2:68364858-68364880 GGCTTGGCATAGAGAGAAGTAGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932852750 2:75201961-75201983 ATGGAGGCAGGGAGAGAAGGCGG - Intergenic
932854630 2:75220360-75220382 AAGAGGGCATGGAGAGATGTTGG - Intergenic
933429905 2:82162923-82162945 AGGTTTGCATTAAGAGAAGTTGG - Intergenic
933591198 2:84234347-84234369 ATGTTAGCCTGGGGAGAAGGAGG + Intergenic
934520885 2:95019469-95019491 ATGTTTGCATGGAGGGTAGTAGG - Intergenic
934859862 2:97755589-97755611 ATGATGGCTTGGAGACAAGGGGG - Intergenic
935350217 2:102145990-102146012 TTCTTGGCACAGAGAGAAGTGGG + Intronic
936397439 2:112140315-112140337 ATGCTGGCCTGGAGAGAGGCAGG - Intronic
936525810 2:113241031-113241053 ATTTTTCCATGCAGAGAAGTGGG + Intronic
937449002 2:121984973-121984995 ATGGTGGAAGGGACAGAAGTTGG + Intergenic
937783433 2:125867150-125867172 ATGTTGGCTTGAAGAGTACTTGG + Intergenic
938730505 2:134143386-134143408 AAGTGGGCAGGGAGTGAAGTGGG + Intronic
938806639 2:134812391-134812413 ATTTTGGCATGGAGGGAAACTGG - Intergenic
938913520 2:135909583-135909605 TTGTTGGAATGGGGAGAAGATGG - Intronic
939547318 2:143569489-143569511 AGGGAGGCATGGAGAGATGTGGG + Intronic
941066289 2:160906737-160906759 ATGTTGGCATTGGGGGAGGTGGG + Intergenic
942687526 2:178549061-178549083 ATGGTGGCATGGAAATAATTGGG - Exonic
944211086 2:197207196-197207218 ATCATGGCATGGAGGGAAGGGGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
945884013 2:215355504-215355526 AAGGTGGCCTGGAGAGAAGCAGG - Intergenic
946127018 2:217571756-217571778 GTGTTGTCATGGAGAGGAGGAGG + Intronic
947854099 2:233311641-233311663 ATGGGGGCAGGTAGAGAAGTGGG - Intronic
1168817259 20:747488-747510 ATGCTATCATTGAGAGAAGTTGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1171385314 20:24765862-24765884 CTGTTGACAAGCAGAGAAGTAGG + Intergenic
1172022460 20:31924229-31924251 ACGTTGGGGTGGAGTGAAGTGGG - Intronic
1174262220 20:49304900-49304922 AGGATGGCAGGGAGAAAAGTGGG - Intergenic
1177733852 21:25063820-25063842 ATGGGGTCATGGGGAGAAGTTGG - Intergenic
1178767191 21:35465549-35465571 GTGTTGGCATCGGTAGAAGTGGG + Intronic
1182280322 22:29214606-29214628 AAGTTGGAGAGGAGAGAAGTTGG + Intronic
1182661015 22:31925195-31925217 ATGTTTGGATGAACAGAAGTTGG - Intergenic
1182950023 22:34365075-34365097 AAGATGGGATGGAGAGAAGGAGG + Intergenic
1183240237 22:36652413-36652435 ATGTTTGCAGGGTGAGAAGAAGG - Intronic
1183336004 22:37246685-37246707 ATGTTAGCATAGAGAGAAACTGG + Intergenic
1184035799 22:41917535-41917557 GTGTTCCCATGGAGAGAAGAGGG - Intergenic
950190257 3:10971700-10971722 ATGTTGGGATGGAGGGACATAGG - Intergenic
951842257 3:27047040-27047062 ATGTTAGCAAGGGGAGGAGTGGG - Intergenic
952205025 3:31172631-31172653 TTGTTGGCATGGAAATAAATTGG + Intergenic
952926505 3:38324167-38324189 ATGATGGCACTGAGACAAGTGGG - Intergenic
953124837 3:40081815-40081837 ATGGGGGCATGGGGAGATGTTGG - Intronic
953269371 3:41424946-41424968 ATGGTGGAATTGACAGAAGTAGG + Intronic
953937978 3:47063029-47063051 ATTTTGGTATGGAGAGAAGGGGG - Intronic
955088146 3:55722703-55722725 AGGTGGGCATGGAAAGAAGTAGG - Intronic
955654564 3:61231093-61231115 ATGTTATCATGAAGAGAAATTGG + Intronic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
957261045 3:77901654-77901676 ATGTTGGCGTGGATTGCAGTTGG + Intergenic
957953275 3:87151056-87151078 AAGTTGGTATGTAGAGAAGTGGG - Intergenic
959643414 3:108667623-108667645 ATGTTACCATGGGGAGAAATTGG + Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961492857 3:127267276-127267298 GTGATGGCAAGGAGACAAGTTGG + Intergenic
962597536 3:136961767-136961789 ATGTTAGCATTCAGGGAAGTTGG + Intronic
962845254 3:139268232-139268254 ATGTTAGAATGGAAAGAGGTAGG - Intronic
963010583 3:140766483-140766505 ATGTTGGGAGGGAATGAAGTGGG - Intergenic
963900675 3:150730268-150730290 ACATTGTCATGGAGAGAAGAAGG - Intergenic
965373768 3:167896301-167896323 TTGTTGTGATGGAGAGAGGTGGG + Intergenic
966895271 3:184440057-184440079 ATGTTTACATGGAGAGTAGTGGG - Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
970680552 4:18502552-18502574 AGGTTTTCATGCAGAGAAGTTGG + Intergenic
971746622 4:30588526-30588548 ATGTTGGCATACAGATAGGTGGG + Intergenic
972093197 4:35314815-35314837 ATGTTGGCATTGAAAGAGGATGG + Intergenic
973158053 4:46982409-46982431 ATGTGAACATGGAGAGAAGATGG + Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974758289 4:66242332-66242354 GTGCTGGAATGGAGAAAAGTTGG - Intergenic
974936899 4:68419800-68419822 ATGTTGGTATGCATAGAGGTGGG + Intergenic
977554150 4:98471717-98471739 ATTTTGGCAGGGTGAGAAGAAGG + Exonic
978613948 4:110574820-110574842 ATGTTGGCATTGAGAGGAAAAGG + Intergenic
979480398 4:121209461-121209483 TAGTTGGCATGGAGAGTTGTGGG + Intronic
980253858 4:130350842-130350864 AGGTTGTCACGGAGAAAAGTAGG - Intergenic
982280932 4:153683531-153683553 ATCTTTGCATGGTGAGAAGTGGG + Intergenic
983293346 4:165834335-165834357 ATGTTGGCAGAGAGAGAGGGAGG + Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
985371631 4:189291486-189291508 AAGTTGGTACTGAGAGAAGTGGG + Intergenic
985562608 5:598179-598201 ATGTTGGCAAGGATGGGAGTGGG - Intergenic
986828729 5:11551287-11551309 ATATTGGCAGGGAAAGAAATGGG - Intronic
986952596 5:13108575-13108597 ATGCTGTCATGGAGAGAATTTGG + Intergenic
986981152 5:13449384-13449406 ATGTGGGCATGGGAAAAAGTTGG - Intergenic
987920786 5:24277527-24277549 ATATTTGCAGGGAGAGAAATGGG - Intergenic
987938460 5:24501037-24501059 TTGTTGCTATGGAGAAAAGTGGG + Intronic
990313072 5:54558369-54558391 ATGATGGAATGGAGAGAGGGAGG - Intergenic
990659888 5:58001587-58001609 ATGTTAGCAGGGAGAAAAGATGG - Intergenic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
990861372 5:60331419-60331441 AAGTTGGCATGAAGAGAAGGAGG - Intronic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
993371400 5:87097124-87097146 ATGGTGGGATGAAGAGAAATAGG - Intergenic
996151774 5:120045873-120045895 ATGTTGCCACTGAAAGAAGTAGG + Intergenic
996207546 5:120760232-120760254 ATGTTGTAATGGATAAAAGTTGG + Intergenic
996294289 5:121893564-121893586 TTGTTGTCATGAAGAGATGTCGG - Intergenic
997284378 5:132667897-132667919 ATGGTGGCAGGGAGAGCTGTGGG - Intergenic
998056872 5:139086065-139086087 ATGTTGCCCAGGAGAGCAGTTGG - Intronic
998924727 5:147109689-147109711 TTGTTGCCATGGAGGGAACTGGG + Intergenic
999037889 5:148373953-148373975 ATGTGGGCGTGGGGAGAAGCAGG - Intergenic
999628176 5:153542046-153542068 AGATTGGGATGAAGAGAAGTAGG - Intronic
1001190986 5:169631097-169631119 AAGATGGCATGTAGATAAGTAGG - Intergenic
1001466921 5:171975632-171975654 ATTTTAGCATGGGAAGAAGTAGG - Intronic
1001630973 5:173175245-173175267 ATTTTTCCATGGACAGAAGTGGG + Intergenic
1001664865 5:173424189-173424211 GTGTTGGCATGAAGTGAACTTGG + Intergenic
1001840323 5:174870691-174870713 AACTGGGCAGGGAGAGAAGTAGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1003354200 6:5350760-5350782 ATGTTATCATGGGGAGAAATTGG + Intronic
1003450163 6:6223362-6223384 TTGTAGGCATGGGGAGAACTTGG + Intronic
1003489648 6:6610237-6610259 ATGTTACCATGAAGGGAAGTGGG + Intronic
1003644001 6:7899518-7899540 ATGTAGGCAGGGAGAGAGGGAGG + Intronic
1003998718 6:11571616-11571638 ATGCAGGCATGCAGAGAAGTGGG - Intronic
1004265039 6:14141993-14142015 ATGTATGCATGGAGTGAAGTTGG + Intergenic
1004435446 6:15588548-15588570 ATGTGGGCATGCAGAGCATTAGG - Intronic
1006175628 6:32119797-32119819 GTGTTGGGGAGGAGAGAAGTAGG - Intronic
1006283578 6:33076431-33076453 AGGTTTGCAGAGAGAGAAGTTGG + Intronic
1006783666 6:36650275-36650297 AAGGTGGCATGGAGACAAGCGGG - Intergenic
1008318196 6:50072892-50072914 ATGTTGGCATGTAGAGACCATGG + Intergenic
1008393699 6:50982203-50982225 ACTTTTACATGGAGAGAAGTGGG - Intergenic
1011219060 6:85034888-85034910 ATGTTGGCCTGGGGAGGTGTGGG + Intergenic
1011720684 6:90153666-90153688 ATATTAGCATGGAGAGAGATTGG - Intronic
1012316730 6:97790495-97790517 ATATTTTCATGGAGAGAACTGGG + Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1014179604 6:118370765-118370787 GAGTTGGCCTGGAGAGAGGTGGG - Intergenic
1015518574 6:134109449-134109471 ACCTTGGGATGGAGTGAAGTGGG + Intergenic
1015864925 6:137718252-137718274 ATGTATGCAAGGAGACAAGTTGG + Intergenic
1017316325 6:153035760-153035782 AGGTTTGCTTTGAGAGAAGTTGG - Intronic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1017769335 6:157633147-157633169 AGGTTGGTTTGGGGAGAAGTAGG + Intronic
1018776028 6:167016814-167016836 TCGTTGGCAGGGAGAGAGGTGGG + Intronic
1019125882 6:169839922-169839944 ATGTGGGCATGGCGTGGAGTGGG - Intergenic
1019125890 6:169839965-169839987 ATGTGGGCATGGGGTGGAGTGGG - Intergenic
1019125898 6:169839992-169840014 ATGTGGGCATGGCGTGGAGTGGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020840600 7:13212970-13212992 TTGGTGGCAGGAAGAGAAGTAGG - Intergenic
1024332371 7:48169088-48169110 AAGTTGGAATGGAGATATGTGGG + Intergenic
1027708749 7:81570213-81570235 ATTTTGGCACAGAGAGAAGCAGG - Intergenic
1030916715 7:115323636-115323658 AGTTTGCCATGCAGAGAAGTAGG - Intergenic
1032791443 7:135245976-135245998 ATGTTGGCTTCCAGAGGAGTTGG + Intronic
1033507255 7:142017319-142017341 ATGATGGCATGAATAGAATTAGG - Intronic
1033770503 7:144546155-144546177 ATGTTGACTTGAAGAAAAGTGGG - Intronic
1036236666 8:7044859-7044881 TCATTGTCATGGAGAGAAGTTGG + Intergenic
1036455953 8:8907703-8907725 ATGTTGGCATGGATATATGATGG + Intergenic
1037000509 8:13712653-13712675 ATGGTTGGATGGAGAGAGGTTGG - Intergenic
1037472583 8:19225103-19225125 ATCAAGGCAAGGAGAGAAGTTGG - Intergenic
1037884293 8:22588375-22588397 ATTTTAAAATGGAGAGAAGTTGG + Intronic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1038522172 8:28243132-28243154 TAGTTTGCATGGAGAGGAGTTGG - Intergenic
1039171703 8:34754808-34754830 ATGTTGGCAAAGAGAGCAGGTGG - Intergenic
1039177753 8:34828386-34828408 ATTAAGGGATGGAGAGAAGTTGG + Intergenic
1041481007 8:58319829-58319851 GTGTTGGAATGGAGATAAGGAGG + Intergenic
1041788282 8:61660278-61660300 ATTTGGGCAGGGGGAGAAGTAGG + Intronic
1043459009 8:80440606-80440628 ATGGTGGTATGGGGAGAAGTTGG + Intergenic
1043749493 8:83917654-83917676 ACATTGACAAGGAGAGAAGTAGG - Intergenic
1043881597 8:85549635-85549657 GGGTAGGCATGGTGAGAAGTGGG + Intergenic
1044091464 8:88007684-88007706 ATTTTGTCATGGAAAGATGTGGG - Intergenic
1045786176 8:105923500-105923522 ATTTTTGCATGGTGAGAGGTAGG - Intergenic
1045826533 8:106404334-106404356 AAGTTGGGATGGAGATATGTAGG - Intronic
1046474819 8:114728742-114728764 ATCTTCACATGGAAAGAAGTTGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1050489699 9:6175299-6175321 AGGTAGGGATGAAGAGAAGTTGG + Intergenic
1050821519 9:9885641-9885663 ATGTGGCCATGGAAAGAGGTTGG + Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1052050876 9:23848914-23848936 CTGTTGCCATGGAGAGAACTGGG - Intergenic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053780011 9:41598023-41598045 CTTTTGGCATGCAGAGAACTTGG - Intergenic
1054167968 9:61808266-61808288 CTTTTGGCATGCAGAGAACTTGG - Intergenic
1054669578 9:67772638-67772660 CTTTTGGCATGCAGAGAACTTGG + Intergenic
1055176249 9:73321143-73321165 GTGTTGGAATGGAAAGAACTAGG - Intergenic
1056666383 9:88584025-88584047 GTGCAGGCATGGAGAGAAGGTGG - Intronic
1057217477 9:93237039-93237061 ATGGTGGCTTTGACAGAAGTAGG + Intronic
1058593499 9:106589854-106589876 ATATTGGAATGGAGAAAAATAGG + Intergenic
1058778398 9:108308873-108308895 ATGGTGGCATGGAAAGAGCTGGG - Intergenic
1059702158 9:116785742-116785764 AAGTCAGCATGGAGAGAGGTGGG - Intronic
1060449047 9:123720096-123720118 ATTGTGGCATGGAGGGAACTGGG - Intronic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186531186 X:10297490-10297512 ATGTTGGAAGGAAGAGAATTAGG + Intergenic
1187900141 X:24020258-24020280 ATATTGGTATGTTGAGAAGTTGG - Intronic
1188603304 X:31996122-31996144 ACATAGGCATGGAGAGAAATTGG + Intronic
1190334892 X:49256354-49256376 ATGTTGGCATGAGGAGTAGCAGG + Intronic
1190568164 X:51752302-51752324 ATCTTTGGGTGGAGAGAAGTTGG - Intergenic
1191219506 X:57972724-57972746 TTGTTGATATGGAGAGAAATGGG + Intergenic
1191795037 X:65012640-65012662 ATGTAGTCATGTAGAGAACTGGG - Intronic
1193090857 X:77492684-77492706 ATGTTAACATGGACAGGAGTAGG - Intergenic
1193161537 X:78233897-78233919 ATGGTGGCATGGAGGGATGGAGG + Intergenic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1196002623 X:110803064-110803086 GTGTTACCATGGAGAGATGTCGG - Intergenic
1196964796 X:121043971-121043993 ATGTTGGCAGTGGCAGAAGTGGG + Intergenic
1197743103 X:129910847-129910869 GTGTTGGCATGGCTAGAAATAGG + Intronic
1197758399 X:130011845-130011867 ATGTAGGCAAGGATAGAAGGAGG + Intronic
1198793367 X:140370037-140370059 ATGGTGGCAAGATGAGAAGTTGG + Intergenic
1199844781 X:151683340-151683362 ATGTTGCCAGGTAGAGAAGCGGG + Intergenic
1199870069 X:151890471-151890493 CAGTTGGCATGGTAAGAAGTGGG + Intergenic
1199977196 X:152901030-152901052 GTGGTGGCAAGGAGTGAAGTGGG + Intergenic
1200596368 Y:5146223-5146245 ATTTTTCCATGGAGAGAGGTAGG - Intronic