ID: 969243594

View in Genome Browser
Species Human (GRCh38)
Location 4:5918182-5918204
Sequence ACCTCCCACCGCAGCAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969243589_969243594 19 Left 969243589 4:5918140-5918162 CCACAAGAAACAAAAGAGGAGGC 0: 1
1: 0
2: 1
3: 42
4: 327
Right 969243594 4:5918182-5918204 ACCTCCCACCGCAGCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969243594 Original CRISPR ACCTCCCACCGCAGCAGGGA TGG Intronic