ID: 969244323

View in Genome Browser
Species Human (GRCh38)
Location 4:5922683-5922705
Sequence CCATGGATGCAGGAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 5, 3: 29, 4: 323}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969244323_969244332 6 Left 969244323 4:5922683-5922705 CCCTCCAGCTCCTGCATCCATGG 0: 1
1: 1
2: 5
3: 29
4: 323
Right 969244332 4:5922712-5922734 CCAGCCTGCAGCGGCCCTCGTGG 0: 1
1: 0
2: 3
3: 16
4: 205
969244323_969244336 22 Left 969244323 4:5922683-5922705 CCCTCCAGCTCCTGCATCCATGG 0: 1
1: 1
2: 5
3: 29
4: 323
Right 969244336 4:5922728-5922750 CTCGTGGCATGCTCATCAAATGG 0: 1
1: 0
2: 1
3: 3
4: 76
969244323_969244337 23 Left 969244323 4:5922683-5922705 CCCTCCAGCTCCTGCATCCATGG 0: 1
1: 1
2: 5
3: 29
4: 323
Right 969244337 4:5922729-5922751 TCGTGGCATGCTCATCAAATGGG 0: 1
1: 0
2: 0
3: 2
4: 51
969244323_969244338 30 Left 969244323 4:5922683-5922705 CCCTCCAGCTCCTGCATCCATGG 0: 1
1: 1
2: 5
3: 29
4: 323
Right 969244338 4:5922736-5922758 ATGCTCATCAAATGGGCAGATGG 0: 1
1: 0
2: 0
3: 12
4: 152
969244323_969244329 -3 Left 969244323 4:5922683-5922705 CCCTCCAGCTCCTGCATCCATGG 0: 1
1: 1
2: 5
3: 29
4: 323
Right 969244329 4:5922703-5922725 TGGCAGTGCCCAGCCTGCAGCGG 0: 1
1: 0
2: 1
3: 64
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969244323 Original CRISPR CCATGGATGCAGGAGCTGGA GGG (reversed) Intronic
900182601 1:1318919-1318941 GCAGGGAGGCAGGGGCTGGAGGG - Intronic
900484231 1:2913955-2913977 ACATGGGTGCTGGAGCTGCAAGG + Intergenic
901219596 1:7575888-7575910 CCAGGGAAGCAGGAACTGGAGGG - Intronic
902608403 1:17582229-17582251 CCATGGCAGCAGGGGCGGGATGG - Intronic
903303142 1:22393135-22393157 GCAAGGAGGCAAGAGCTGGAGGG + Intergenic
905237659 1:36561211-36561233 CCAGGGATGCAGGAGCACGCGGG - Intergenic
905371446 1:37484607-37484629 CCATGGACGCACGAGCGGGCAGG + Intergenic
906294210 1:44639260-44639282 TCCAGGATCCAGGAGCTGGATGG - Intronic
907208351 1:52795256-52795278 ACATGGGTGAAGGAGATGGAAGG - Intronic
907270660 1:53288991-53289013 CCATGGAGGCAGGAGCTCCTAGG + Intronic
907808510 1:57844889-57844911 CCAAGGCTGAAGGAGCTGGCGGG - Intronic
909068449 1:70963617-70963639 CCATGGCTGGAGCAGCTGCAGGG + Intronic
909371178 1:74885100-74885122 CCATGGCTGGAGCAGCTGGGAGG - Intergenic
909649269 1:77955394-77955416 CCTTGGGTGCAGGAGCTGGCAGG + Intronic
911011776 1:93288412-93288434 CCATGGCTGGAGCAGCTGGGAGG - Intergenic
912460129 1:109824899-109824921 CCCTGGGTGCATGAGGTGGAAGG - Intergenic
916051018 1:161037195-161037217 CCATGGATTGAGGAGGTGAAAGG - Intronic
916213181 1:162374665-162374687 CCAAGGATGCTGGAGCAGAAAGG + Intronic
916857239 1:168762646-168762668 CGTTGGTTGCAGAAGCTGGAAGG + Intergenic
916865288 1:168849890-168849912 CTAAGGAGGCTGGAGCTGGAAGG + Intergenic
917341886 1:173988235-173988257 CCATGGATTCAGGAGTAGGGAGG - Intronic
917571055 1:176265878-176265900 GCAAAGAGGCAGGAGCTGGAGGG + Intergenic
919797733 1:201331500-201331522 GCATGGAGGTAGAAGCTGGAAGG - Exonic
1062923564 10:1297807-1297829 CCATGGAGGCAGGGGCTGGAGGG + Intronic
1063380429 10:5582154-5582176 TCCTGGCTGCAGGAGCTGGACGG - Intergenic
1064589090 10:16869809-16869831 TCATGGGAGCAGGAGGTGGAGGG + Exonic
1065306536 10:24374433-24374455 CCTTGGGTGCAGGCGCTAGAGGG - Intronic
1067582201 10:47452854-47452876 CCTTGGGTGCAGGGGCTGGCGGG - Intergenic
1067901263 10:50244087-50244109 GCAAAGAAGCAGGAGCTGGAGGG + Intronic
1069689692 10:70341951-70341973 CCAAGGCTGCAGGGGATGGAGGG + Intronic
1069876008 10:71563277-71563299 GCTGGAATGCAGGAGCTGGAAGG - Intronic
1070161597 10:73870192-73870214 GCTTGGATGCAGGAGCTAGTGGG - Intronic
1075342943 10:121661749-121661771 CCATGGAAGCAATAGCAGGAAGG + Intergenic
1075712652 10:124538861-124538883 CCACGGCTGCAGGAGCTGAGTGG - Intronic
1075980700 10:126736728-126736750 CAATGGTTGCAGGAGCTGACAGG - Intergenic
1076501480 10:130939735-130939757 GCACGGATGCTGGAGATGGAGGG + Intergenic
1077103599 11:832727-832749 CCAAGGACGGAGGAGCTGGGCGG - Intergenic
1077269259 11:1667399-1667421 CCAGGGCTGCAGGAGCAGGGTGG - Intergenic
1077271286 11:1683306-1683328 CCAGGGCTGCAGGAGCAGGGTGG + Intergenic
1077352482 11:2099357-2099379 TCAGGGCTGCAGGAGCTGGGTGG - Intergenic
1078320731 11:10332385-10332407 ACATGGTGGCAGGAGATGGAGGG + Intronic
1080408849 11:32004478-32004500 AAATGCCTGCAGGAGCTGGATGG - Intronic
1080863135 11:36167892-36167914 ACATGGATGCAGTGTCTGGAAGG + Intronic
1083178681 11:60970677-60970699 GCAAGGATGCAGGAAGTGGAGGG + Intergenic
1083222154 11:61259440-61259462 TCCTGGAGGCAGGAGCTGGCTGG - Intronic
1084248018 11:67873413-67873435 CGATGGCAGCAGCAGCTGGAGGG + Intergenic
1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG + Intergenic
1084412996 11:69014753-69014775 CCATGGCTCCGGGGGCTGGAAGG + Intergenic
1084557365 11:69883083-69883105 CCACGGAGGCAGGGGCTGGTGGG - Intergenic
1085466027 11:76723912-76723934 CCTTGGCTGCAGGGGCTGCAGGG - Intergenic
1085516549 11:77115321-77115343 CCAGGGACTCAGGTGCTGGAGGG - Intronic
1085804303 11:79620486-79620508 CCATCCATGTAGGAACTGGATGG - Intergenic
1086275318 11:85120979-85121001 CTATGCATACAGGAGCTGAATGG - Intronic
1089630315 11:119780124-119780146 CCCTGGAGGCAGGGGCTGGGGGG + Intergenic
1090350654 11:126105790-126105812 CAATAGCTGCAGGAGCAGGAGGG - Intergenic
1091083175 11:132692355-132692377 CTATAGATGCATGAGCTGCATGG - Intronic
1091288099 11:134420111-134420133 CTGTGGAGGAAGGAGCTGGAGGG - Intergenic
1096499412 12:52055936-52055958 CAATGGCAGCAGGATCTGGACGG + Intronic
1096537524 12:52284880-52284902 CCATGCATGAAGGAGCTGAATGG + Intronic
1096679026 12:53242503-53242525 GCAAGGAGGCAGGAGCTGGGTGG + Intergenic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1099373451 12:81866332-81866354 CCAAGGATGTATGAGCTGGCAGG - Intergenic
1101345877 12:103885682-103885704 GCCTGGAATCAGGAGCTGGAGGG - Intergenic
1103524646 12:121559554-121559576 CCAGGGAGGCAGGAGATGTAGGG + Intronic
1104226395 12:126838420-126838442 CCATGAATGGATGAGCTGGCAGG - Intergenic
1104519382 12:129458882-129458904 CCTTGGATGTCAGAGCTGGAAGG + Intronic
1104592780 12:130098099-130098121 CCAGGGAAGCAGGAGCTCCAGGG + Intergenic
1104769764 12:131354049-131354071 CCAGGGAGGGAGCAGCTGGAAGG + Intergenic
1105014180 12:132776180-132776202 GCAGGGAGGAAGGAGCTGGAGGG - Intronic
1105014211 12:132776339-132776361 GCAGGGAGGAAGGAGCTGGAGGG - Intronic
1105014228 12:132776416-132776438 GCAGGGAGGAAGGAGCTGGAGGG - Intronic
1105014262 12:132776574-132776596 GCAGGGAGGAAGGAGCTGGAGGG - Intronic
1106083131 13:26517108-26517130 CCAAGGATTAAGGAGCTGGAAGG - Intergenic
1106559368 13:30835226-30835248 CCATGGACCTAGCAGCTGGAAGG + Intergenic
1106665575 13:31847157-31847179 ACATGGAGGCAGGAGGAGGACGG - Intergenic
1106842506 13:33699472-33699494 CCGTGATTGCAGGGGCTGGATGG - Intergenic
1107642097 13:42454002-42454024 CCTTGAATCCAGGAGGTGGAGGG - Intergenic
1108214954 13:48174949-48174971 CCATGGAGGTAGAAGCTGCAGGG - Intergenic
1109058589 13:57582943-57582965 CCATGGATGTGTGAGCTGGCAGG - Intergenic
1109317425 13:60766775-60766797 CCATGGATGAAGAAGAGGGATGG + Intergenic
1110746985 13:79065464-79065486 CCTTGGAGGCAGGAGATGGCAGG - Intergenic
1110975173 13:81823567-81823589 AGATGGATGCATGAGCTTGAAGG + Intergenic
1112092479 13:96095925-96095947 CCATAGATACAGCTGCTGGATGG + Intronic
1112315452 13:98358218-98358240 CCATGAGTGCAAGAGATGGAGGG - Intronic
1112374690 13:98828064-98828086 CCACGGAGGCAGGAACTGGAGGG + Intronic
1113958648 13:114113057-114113079 ACTTGGGGGCAGGAGCTGGAGGG + Intronic
1114228168 14:20757511-20757533 CCATGGCGGCAGGAGCTGCTGGG - Intergenic
1115144562 14:30211415-30211437 TCAGGGATGCAAGAGCTGCATGG - Intergenic
1118733735 14:68687595-68687617 GCATGGAAGAAGGAGCTGGTTGG + Intronic
1119407790 14:74409571-74409593 CCCTGGGTCCAGGAGCTGGTGGG + Exonic
1121377742 14:93430196-93430218 CCACGGATGGTGAAGCTGGAAGG - Intronic
1123180665 14:106467220-106467242 GCATGGGTGCAGGAGCGGAAGGG + Intergenic
1123456155 15:20427836-20427858 CCATGGATGTGTGAGCTGGCAGG - Intergenic
1123635413 15:22303001-22303023 CCATGGATGTGTGAGCTGGCAGG + Intergenic
1124247047 15:28079826-28079848 ACATGGGGGCAGGAGCTGGCAGG - Intronic
1125931342 15:43602261-43602283 CCATGAGTGCAGGAGGTGGAGGG - Intronic
1127965911 15:63922865-63922887 CAGTGGATTCAGGAGCTGGTGGG - Intronic
1129156050 15:73718816-73718838 CCCTGGATGCAGGAGGTGAGAGG - Intergenic
1129940813 15:79495287-79495309 CCAAGGATGTGGGAGGTGGAAGG + Intergenic
1130149389 15:81299774-81299796 CCCTGGAAGCAGGTGCTGGCTGG - Exonic
1131497003 15:92921240-92921262 CAGTGGGTGCAGGAGCTAGAGGG + Intronic
1133985125 16:10662551-10662573 GCAAAGAGGCAGGAGCTGGAAGG - Intronic
1134208119 16:12253956-12253978 ATGTGGATGCTGGAGCTGGAAGG + Intronic
1135434933 16:22420526-22420548 CTGTGGATGCAGGAGATGGACGG - Intronic
1135817847 16:25652244-25652266 CCATGGATGGAAGGGATGGAGGG + Intergenic
1137061511 16:35794931-35794953 CCATGGATTCAGGAGCCACAGGG + Intergenic
1137458543 16:48637108-48637130 CCATGCTTCCAGGAGGTGGATGG + Intergenic
1137496977 16:48977692-48977714 CCATGGTGCCAGGAGCTGGGGGG - Intergenic
1137764358 16:50966697-50966719 CAATGGATGCTGGAGTTGGCAGG - Intergenic
1139190000 16:64851799-64851821 CCTAGGATGCAGTGGCTGGAAGG - Intergenic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140383363 16:74511010-74511032 CCATGGAAGCAAGGGGTGGAGGG + Intronic
1141576383 16:84966589-84966611 CCAGGGAAGGAGGGGCTGGAGGG + Intergenic
1141610261 16:85177164-85177186 CCCTGGAAGCAGGAGGGGGAAGG + Intronic
1141630271 16:85283889-85283911 GCATGGATGCTGGAGCCAGACGG - Intergenic
1141798803 16:86293148-86293170 CCATGGGTGCCGGGGCTGGGAGG + Intergenic
1142044116 16:87914302-87914324 CTGTGGATGCAGGAGATGGACGG - Intronic
1143462503 17:7112827-7112849 CCATGGAGGCAGGAGGAGCAGGG - Intronic
1144028317 17:11297880-11297902 AAATGGATGGCGGAGCTGGAGGG + Intronic
1144394189 17:14827631-14827653 CAATGGAGGGAGGAGCTGAAAGG + Intergenic
1144397099 17:14855069-14855091 CCATGGCTGCACAATCTGGAGGG - Intergenic
1144891758 17:18498308-18498330 CCAGGGAAGGCGGAGCTGGAAGG - Intergenic
1145140464 17:20446009-20446031 CCAGGGAAGGCGGAGCTGGAAGG + Intergenic
1145795407 17:27652656-27652678 CCAGGGAAGGCGGAGCTGGAAGG - Intergenic
1146176086 17:30667489-30667511 CGAGGGAGGCAGGAGCTGTAAGG + Intergenic
1146349544 17:32083599-32083621 CGAGGGAGGCAGGAGCTGTATGG + Intergenic
1146637186 17:34515052-34515074 TCCTGGCTGCAGGAGTTGGATGG - Intergenic
1148126652 17:45240920-45240942 CCAGTGATGCGGGAGGTGGAGGG - Intronic
1148138203 17:45309371-45309393 CCATGACTATAGGAGCTGGAGGG - Intronic
1150651996 17:67016407-67016429 CCTTGGAGGCAGCAGCTGAAGGG + Intronic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151342406 17:73480436-73480458 CCCAGGAAGAAGGAGCTGGATGG + Intronic
1151422031 17:74005071-74005093 CCATAGGTGCTGGAGCAGGAGGG - Intergenic
1152649138 17:81483906-81483928 CCATGGATGTGGGCGCTGGGAGG - Intergenic
1153581901 18:6582236-6582258 CCATGGATGTGTGAGCTGGCAGG + Intronic
1153651594 18:7245824-7245846 CCATGGCTTCAGGAGCTAGAAGG - Intergenic
1153793657 18:8602847-8602869 CCATGGATGGAGATGCTGGTGGG + Intergenic
1154001322 18:10484588-10484610 TGGTGGTTGCAGGAGCTGGAAGG - Intronic
1154111126 18:11569380-11569402 CCAAAGATGCTGGAGATGGAAGG - Intergenic
1155390435 18:25329934-25329956 CTATGGAAACAGGATCTGGATGG + Intronic
1157347259 18:46850718-46850740 CAATGGATGCCGAAGCTTGACGG - Intronic
1157571406 18:48714743-48714765 CCCTGGAATTAGGAGCTGGATGG + Intronic
1157598863 18:48880524-48880546 GCCTGGATGCTGGGGCTGGAAGG + Intergenic
1157869301 18:51215121-51215143 CCATAGATGAAGCAGCTTGATGG - Intronic
1159418840 18:68188490-68188512 GCAAGGAAGCAGGAACTGGAAGG - Intergenic
1160945006 19:1637527-1637549 ACATGGAAGCAAGAGCGGGATGG - Intronic
1161349064 19:3782624-3782646 CCATGCAGGCAGGTTCTGGAAGG + Intronic
1162199245 19:9009050-9009072 CCCCGGATGGAGGAGGTGGATGG + Intergenic
1162790067 19:13058124-13058146 CCAGAGAAGCAGGAGCTGGGAGG - Intronic
1164552107 19:29220694-29220716 CCATGAATGCCAGAGCTGGAAGG + Intergenic
1164644131 19:29845421-29845443 CCCTGGAGGCAGCAGCTAGAGGG - Intergenic
1164726642 19:30469791-30469813 CCAGGGATGCCAGAGGTGGATGG + Intronic
1166090005 19:40502758-40502780 CCATGCCTGCAGGAGATGGGAGG - Exonic
1166126934 19:40720577-40720599 CCATGGAGGCAGATTCTGGAAGG - Intronic
1166863762 19:45824054-45824076 CCATGTCTGGAGGAGCTGCAGGG - Intronic
1167198781 19:48049557-48049579 CCACGGCTGCAGGACCTGGGCGG + Intronic
1167239011 19:48332245-48332267 GGATGGCTGCAGGAGTTGGAGGG - Intergenic
1167261305 19:48460173-48460195 GCATGGACCCTGGAGCTGGATGG + Intronic
1167687527 19:50965975-50965997 GCATAGTTGGAGGAGCTGGAGGG - Intronic
1168444708 19:56402047-56402069 GCAAAGAGGCAGGAGCTGGAAGG - Intronic
1168513026 19:56988478-56988500 CCATGGAAACTGCAGCTGGAGGG - Intergenic
925023983 2:593743-593765 CCAGGGCTGCAGTAGCTGGCTGG + Intergenic
925455419 2:4012442-4012464 CCATGGTTCCTGGAGGTGGAAGG + Intergenic
926707051 2:15844305-15844327 CCATGGAAACAGGAGAAGGAAGG - Intergenic
927285673 2:21354455-21354477 CCAAAGAGGCAGGGGCTGGAGGG - Intergenic
927946817 2:27139644-27139666 CAATGGATGAAGGAGGTGGTTGG - Intergenic
928023895 2:27724259-27724281 GCCTGGGTGCAGGAGGTGGAGGG - Intergenic
929049365 2:37822708-37822730 CATGGGATGAAGGAGCTGGAGGG - Intergenic
930193797 2:48488246-48488268 CCGTGGATGAAGGAGGTGAAAGG - Intronic
930996533 2:57726122-57726144 ACATGAAAGCAGTAGCTGGAAGG - Intergenic
931199258 2:60081175-60081197 ACATGGCTGCAGTAGTTGGAGGG + Intergenic
931213481 2:60219818-60219840 CCATGGATGGACGAGCAAGAAGG - Intergenic
932048227 2:68371682-68371704 CCATGGGCTCTGGAGCTGGATGG - Intronic
932219412 2:69988491-69988513 CGGTGGTTGCAGGAGCTGCAGGG + Intergenic
934624795 2:95836846-95836868 CCAAGGATGCTGGAGCTGCCTGG - Intergenic
935926681 2:108077405-108077427 CCAAGGATGTCGGAGTTGGAAGG - Intergenic
936042199 2:109158507-109158529 CCTTGGCTGGGGGAGCTGGATGG + Intronic
936074634 2:109394009-109394031 CCATGGCTCCAGGAGCTGCGGGG + Intronic
937265332 2:120611701-120611723 CCATGAAGGCAAGAGCTGGAAGG - Intergenic
940339317 2:152563070-152563092 CCCTGGATGCTGGAGGTCGAGGG + Intronic
942555168 2:177165348-177165370 CCATGGCTGCAGAAGCTGTAGGG + Intergenic
943241552 2:185390590-185390612 CCACGGATGCAGTTGCTGGCTGG + Intergenic
943295173 2:186129194-186129216 GCATGAGTGCAGGTGCTGGAAGG + Intergenic
943455519 2:188102713-188102735 CCCTGGATGCTTGAGCTGGCAGG + Intergenic
946507333 2:220315690-220315712 CCATGAAAGTAGGAGCTGGTAGG + Intergenic
947710441 2:232310802-232310824 CCATGGGTCCAGGAGCAGGGAGG + Intronic
948458534 2:238118361-238118383 GAATGGATGGAGGAGGTGGATGG + Intronic
948458781 2:238119301-238119323 AAATGGATGAAGGAGTTGGATGG + Intronic
948458800 2:238119380-238119402 AGTTGGATGCAGGAGGTGGATGG + Intronic
948458825 2:238119468-238119490 GAATGGATGGAGGAGGTGGATGG + Intronic
948458854 2:238119562-238119584 GAATGGATGGAGGAGGTGGATGG + Intronic
948871023 2:240798131-240798153 CTGTGGATGCAGGCGCTGGTGGG + Intronic
1169266620 20:4171021-4171043 CCATGGAAGCAGGAGCAAGAAGG + Intronic
1170523411 20:17212251-17212273 ACATGGATGGAGCTGCTGGAGGG + Intergenic
1170877855 20:20267527-20267549 CTGTGGATGCAGGAGCTAGCTGG + Intronic
1171948152 20:31396816-31396838 CCAAGGTAGCAGGTGCTGGACGG - Intergenic
1172268742 20:33640172-33640194 CCATCCATGCAGGTGCTGGCTGG - Intronic
1173201310 20:40957264-40957286 CCATGGATAAAGGGGCAGGAAGG - Intergenic
1173317669 20:41959714-41959736 CCATGGTTGCAGGAACTAGGAGG + Intergenic
1173590541 20:44221455-44221477 CCATTGATTCAGTGGCTGGAGGG + Intergenic
1175400363 20:58696676-58696698 CGAGTGACGCAGGAGCTGGAAGG - Intronic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175465159 20:59185743-59185765 CCACTGAGGCAGGAGCTGGACGG + Intergenic
1176118476 20:63443680-63443702 CCAGGGATATAGGGGCTGGATGG + Intronic
1177265271 21:18775119-18775141 CCATTGCTCCAGGAGCAGGAGGG - Intergenic
1178301548 21:31457790-31457812 CCCTGGAGGCAGGAGGTGGGGGG - Intronic
1178361052 21:31948720-31948742 CCAGGGAAACAGAAGCTGGAAGG + Intronic
1179363313 21:40733118-40733140 ACATGCATGCAGGTGCTGGAGGG + Intronic
1179778923 21:43687167-43687189 GCAGGGAAGCAGGAGCTGCAGGG + Intronic
1180983351 22:19889989-19890011 CCATGTATGCAGGTGCCGGCTGG + Intronic
1181084019 22:20430977-20430999 CCAGGGAGGGAGGAGGTGGAAGG - Intronic
1182806775 22:33078998-33079020 GCATGGATGCTGGAGCTGGATGG + Intergenic
1183429723 22:37758184-37758206 GCATGAATGCAGGGACTGGAGGG - Intronic
1184264766 22:43341219-43341241 ACAAGGAGGCAGGAACTGGAGGG + Intronic
1184684307 22:46089202-46089224 CCCAGGCAGCAGGAGCTGGAAGG - Intronic
1184730713 22:46369635-46369657 CCAAACATGCATGAGCTGGAAGG - Intronic
1185021775 22:48380626-48380648 ACAGGCCTGCAGGAGCTGGAAGG + Intergenic
1185137920 22:49083824-49083846 CCCTGGATGCAGGAGGTGCTGGG + Intergenic
949949112 3:9214654-9214676 CCATGGATGGAGAAGCTGGAAGG + Intronic
950020187 3:9781652-9781674 TCATCGATGGTGGAGCTGGAAGG + Intronic
950194166 3:10997391-10997413 CCCTGGCTGCTGGGGCTGGATGG + Intronic
950449747 3:13058961-13058983 CTCTGGGTGCAGGAGGTGGATGG + Intronic
950537120 3:13585089-13585111 GCCTGGATGCAGGAGCAGGGAGG + Intronic
950642088 3:14354875-14354897 CCAGGGCTCCAGGAGTTGGAGGG + Intergenic
950725531 3:14914529-14914551 CCATGGCAGCAGGAACTTGAGGG + Intronic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
953025407 3:39142226-39142248 CCAGGGATGTAGGAGGGGGAAGG - Exonic
953586925 3:44210055-44210077 CCAGGGTTGCAGGACCTGGGAGG - Intergenic
954193987 3:48985242-48985264 CCCTGGATGCTGGAGCTGGAGGG + Exonic
954224364 3:49172768-49172790 CCATGTCTGCAGGAGGTGGCCGG + Exonic
954364217 3:50137781-50137803 CCAGGGCTGGAGGAGCAGGAGGG - Intergenic
954618139 3:51980728-51980750 CCTTGGATGGAAGAGTTGGATGG + Intronic
954693251 3:52407000-52407022 CCAGGGAATCAGGAGCTGGTCGG + Intronic
954998018 3:54899827-54899849 CCGTTCATCCAGGAGCTGGATGG - Exonic
955369300 3:58337428-58337450 CCATGGATGCAGGAGCTGTCTGG - Intronic
960056212 3:113278375-113278397 ACAAGGAGGCAGTAGCTGGAAGG - Intronic
960113329 3:113867366-113867388 CCCTGGATGCAGAAGTTGCAGGG - Intronic
960782009 3:121330255-121330277 CCAAGTATGTGGGAGCTGGATGG + Intronic
960962954 3:123084848-123084870 CCAGGGAGGCCGGAGGTGGAGGG - Intronic
962282377 3:134061567-134061589 CCAGGGAGGCAGGGGCTGGATGG + Intergenic
962315022 3:134354002-134354024 CCATGGCTGCAAGGGCTGGAGGG - Intergenic
962735051 3:138318246-138318268 CCCTGGATGCAGGGGGTGCAGGG + Intronic
966869579 3:184281461-184281483 CAATGGATGAGGGAGCAGGAGGG + Intronic
967371337 3:188749871-188749893 CCATGGAGGCAGGTACTGTATGG + Intronic
968076853 3:195820693-195820715 CGATGGAGGCAGAGGCTGGAGGG - Intergenic
968284134 3:197498511-197498533 CCAGGGCTGAAGCAGCTGGAAGG - Intergenic
968590938 4:1459317-1459339 CCATGGATGCAGGTGGCTGAGGG + Intergenic
968947585 4:3673701-3673723 CCCTGGATGCTGCAGCTTGAAGG + Intergenic
969238935 4:5887370-5887392 CCATGTATGCAGGAGCAGCCCGG - Intronic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
969502379 4:7560949-7560971 CCATGGCTGCAGAAGCAAGATGG + Intronic
970641856 4:18075646-18075668 CCATGGCTGCACAAGCTGAAAGG - Intergenic
971004266 4:22356607-22356629 CCATGGATGCATGAACTGGCAGG + Intronic
971141764 4:23932327-23932349 CCCTGGAGGCAGGAGGAGGATGG - Intergenic
974121960 4:57649649-57649671 CCATGAATGAAGCAGCAGGAAGG - Intergenic
974227403 4:59064671-59064693 CCATGTACCCAGGAGATGGAGGG + Intergenic
980863002 4:138521777-138521799 CCATGGATGTATGAGCTGGCAGG + Intergenic
981014448 4:139959326-139959348 CCATGGATGCAGAATCAAGACGG - Intronic
982297874 4:153848546-153848568 CAGTGGAAGAAGGAGCTGGAGGG - Intergenic
986216737 5:5726484-5726506 TCATGGACACAGGAGATGGAGGG - Intergenic
990636356 5:57732162-57732184 CCATGGATGAAGCAGTTGGTGGG + Intergenic
990659949 5:58002099-58002121 CCACTGATGCAGGAGCTGGCAGG + Intergenic
991007195 5:61840971-61840993 CCATGCTTGCAGGAGGTGAATGG - Intergenic
992756483 5:79911390-79911412 CCTGGGATGCAGGAGCTTGGCGG + Intergenic
993860579 5:93131911-93131933 TGGTGAATGCAGGAGCTGGAAGG - Intergenic
994213066 5:97107549-97107571 CCATTGATGCAGGAGTGGAATGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995973043 5:117996518-117996540 CCATGGATGTAAGAGTGGGATGG + Intergenic
996815307 5:127567353-127567375 GCAAAGATGCAGGGGCTGGAGGG - Intergenic
998123300 5:139597233-139597255 CCATGGTTCCAGTGGCTGGAGGG - Intronic
999115695 5:149161358-149161380 CCATGGAGGAAGTAGGTGGAGGG - Intronic
999495443 5:152092008-152092030 AAATTGAGGCAGGAGCTGGAAGG - Intergenic
999889573 5:155962504-155962526 CCTTTGATGCAGGAGCTTGCAGG - Intronic
1000230881 5:159314085-159314107 CCATGGAAGGAGGAGATGGTGGG - Intergenic
1000274193 5:159718393-159718415 CCAGGGATGAAGGAGTGGGAAGG + Intergenic
1000642411 5:163718404-163718426 CCATGGACACTTGAGCTGGAAGG + Intergenic
1001033156 5:168277453-168277475 CCCTGGATGCAAGAACTGGGTGG + Intergenic
1002701823 5:181130113-181130135 CAATGGGAGCAGGAGCTGCAGGG + Intergenic
1003145977 6:3511102-3511124 CCATGGATTCAGAAGACGGAGGG + Intergenic
1003602102 6:7526984-7527006 CCATGGAGGCTGGAGGGGGAAGG - Intergenic
1004013493 6:11711242-11711264 CCATAGAAACAGGAGCTGCAAGG + Intergenic
1004555300 6:16691283-16691305 CCATGGATGCCGTAGGTGTAAGG - Intronic
1005509569 6:26500428-26500450 CCAAGGAGAAAGGAGCTGGAGGG - Intergenic
1006000009 6:30957074-30957096 ACCTGGATGCAGGAGGTGGGAGG - Intergenic
1006451015 6:34105706-34105728 CCAGGGGAGCAGCAGCTGGATGG - Intronic
1006743117 6:36323292-36323314 CCAAGGCTGCTGGAGGTGGAGGG + Exonic
1006743677 6:36326509-36326531 CCATAGCTGCTGGAGATGGAAGG + Exonic
1006790308 6:36696822-36696844 CCATGGTTGCAGAAGAAGGAAGG - Intergenic
1008332762 6:50262653-50262675 CCATGGCTGCAGCAGCTGGGAGG + Intergenic
1008891510 6:56497869-56497891 CAAAGGAAGCAGCAGCTGGATGG - Exonic
1010351366 6:74878936-74878958 CAATGGATGCAGTCACTGGATGG + Intergenic
1012523300 6:100146475-100146497 ACCTGGAGGCAGGAGCTGTAGGG + Intergenic
1017008695 6:150047162-150047184 ACTTGAATGCAGGAGCTGGCAGG - Intergenic
1017025724 6:150178904-150178926 ACATGGATGCTGGAGGTGAAGGG + Intronic
1017786563 6:157761760-157761782 CCGTGGAAGCAGGTGCAGGAAGG + Intronic
1018952685 6:168389334-168389356 CCAGGGATTCAGGAGATGGCGGG - Intergenic
1019103537 6:169650596-169650618 GCATGGATGGAGGGGATGGAGGG - Intronic
1019111633 6:169721957-169721979 CCAGGCATGCCAGAGCTGGACGG + Intronic
1019560518 7:1654231-1654253 CGCTGGCTCCAGGAGCTGGATGG - Intergenic
1019844196 7:3480553-3480575 CTCTGGTTGCAGGAGCTGGAAGG - Intronic
1020555923 7:9670208-9670230 CAATGGGTGGAGGAGGTGGAAGG + Intergenic
1021269668 7:18570590-18570612 TCATGGACTCTGGAGCTGGACGG + Intronic
1021767386 7:23963543-23963565 CTCTGGAGGCAGGATCTGGATGG + Intergenic
1023051752 7:36258673-36258695 CCTGGGATGCTGGAGCTGGTGGG - Intronic
1023681313 7:42690646-42690668 TTAAGGAGGCAGGAGCTGGAGGG + Intergenic
1023743430 7:43301318-43301340 ACATGGAAGCTGGACCTGGAAGG - Intronic
1024550979 7:50562194-50562216 CCATGAGTGCAGGGGCTGCAGGG + Intronic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1028612482 7:92727252-92727274 CCATGGATTTCAGAGCTGGAAGG + Intronic
1028807332 7:95043606-95043628 GCAAAGATGCAGGGGCTGGAGGG - Intronic
1031526371 7:122826007-122826029 CCATGGACACAGGAGGTGGTAGG - Intronic
1031657427 7:124375052-124375074 GCATGGACTCAGGAGCTAGAGGG - Intergenic
1031774221 7:125886273-125886295 CCATGACTGCAGGAGTTTGAGGG + Intergenic
1032394003 7:131575965-131575987 CCATCACTGCAGGAGCTGGGAGG + Intergenic
1034470571 7:151252216-151252238 ACATGGAAGAAGGGGCTGGAAGG + Intronic
1035027082 7:155833112-155833134 CAAAGGATGTTGGAGCTGGAAGG + Intergenic
1035112137 7:156492111-156492133 CCAAGGAGGCATGAGCGGGAAGG - Intergenic
1035391340 7:158506850-158506872 CGATGGTTGCAAGAGCAGGATGG + Intronic
1036096698 8:5732853-5732875 CCATGGAGGCAGGAACAGGCAGG - Intergenic
1036668391 8:10763443-10763465 ACATGGGTGCAGGAGCTGGGTGG - Intronic
1037137503 8:15480678-15480700 CCAAGGATGCAGGTGCAGGGAGG - Intronic
1039552233 8:38451448-38451470 CCAGGGATGGAGGACCTGCAAGG + Intronic
1040566874 8:48575222-48575244 CCATGGATGCTGGAACAGAAAGG + Intergenic
1041190546 8:55349473-55349495 CAGAGGATGCAGAAGCTGGAGGG - Intronic
1041766787 8:61427277-61427299 CCAAGAAAGCAGGTGCTGGAAGG - Intronic
1042351126 8:67778828-67778850 CAATGGAGGCAGAAGCTGGGTGG - Intergenic
1042611388 8:70605375-70605397 GCATGGATTCTGGAGCTGAAGGG - Intronic
1044170799 8:89049686-89049708 CCATGGTGGCAGGAGGTGGCAGG + Intergenic
1044171503 8:89058000-89058022 CAATGGTTGCAGCAGCTGAAAGG + Intergenic
1048865210 8:138755741-138755763 TCATGGATGCAGGTGCTGGTGGG - Intronic
1049492293 8:142911848-142911870 CCATTTGTGCAGGAGCTGGCTGG + Exonic
1049566991 8:143345472-143345494 GCGTGGCAGCAGGAGCTGGAGGG - Intronic
1051869473 9:21720218-21720240 TCATGGATGTCAGAGCTGGAAGG - Intergenic
1052736938 9:32352370-32352392 CCATGGAGGCTGCAGCTGGCAGG - Intergenic
1053447469 9:38164137-38164159 CCATGGGTGCAGGGACTGAAGGG + Intergenic
1057586329 9:96331948-96331970 CCATGGATGCAGGATGGGTAAGG - Intronic
1058901222 9:109443898-109443920 GCATGGAACCAGGAGGTGGAGGG - Intronic
1059383622 9:113947544-113947566 ACATGGCTGTAGGAGCTGGAAGG - Intronic
1060233126 9:121840342-121840364 CGATGGATGCACAGGCTGGAGGG + Intronic
1061582295 9:131545614-131545636 CCATGGAGGCAGGAGCTGGAGGG + Intergenic
1061948481 9:133922031-133922053 CCATGCATGCAGGCACGGGATGG + Intronic
1062225071 9:135445608-135445630 AGGTGGTTGCAGGAGCTGGAAGG + Intergenic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1185472822 X:394888-394910 CCATGGAGGCAGAAAGTGGATGG - Intergenic
1187009467 X:15265293-15265315 CCTTGGATGCAGGATGAGGAGGG - Intronic
1188872701 X:35393272-35393294 CAATGAAGGCAGGAGCTGCAAGG + Intergenic
1189905106 X:45750754-45750776 TCAGGTATGCAAGAGCTGGACGG - Intergenic
1190738129 X:53269249-53269271 GAACGGATGCTGGAGCTGGAAGG - Intronic
1191715047 X:64188438-64188460 GCATGGATGCAGGAGAAGGGAGG + Exonic
1191842409 X:65522643-65522665 CAAGGGATGCAGGAAATGGAGGG + Intronic
1191969669 X:66799321-66799343 CCAGGGATGCTGGAGCTTGGTGG + Intergenic
1191975853 X:66870122-66870144 ATATGGATGCAGTAACTGGATGG + Intergenic
1194100239 X:89694371-89694393 CCATGGATGTGTGAGCTGGTAGG - Intergenic
1194614714 X:96086845-96086867 CAATGTGTGCGGGAGCTGGATGG + Intergenic
1195706548 X:107741816-107741838 GCAAGGCTGCAGGAGATGGATGG + Intronic
1197700301 X:129594684-129594706 CCATTGATGCAGGGCCTGGTGGG - Intergenic
1198815012 X:140580487-140580509 CCAGGGATGCAGTAGGTGGCAGG - Intergenic
1199649785 X:149939722-149939744 CCTTGGAAGCAGGCGTTGGAGGG + Intergenic
1200453238 Y:3355730-3355752 CCATGGATGTGTGAGCTGGTAGG - Intergenic