ID: 969244944

View in Genome Browser
Species Human (GRCh38)
Location 4:5925806-5925828
Sequence CATCCCCCGCTGCCAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969244944_969244950 0 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244950 4:5925829-5925851 AGCTGGAGTTCACCAGGTGATGG 0: 1
1: 1
2: 5
3: 29
4: 197
969244944_969244952 8 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244952 4:5925837-5925859 TTCACCAGGTGATGGAAGTTGGG No data
969244944_969244951 7 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244951 4:5925836-5925858 GTTCACCAGGTGATGGAAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 176
969244944_969244959 28 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244959 4:5925857-5925879 GGGAAGGGGGTCTTAAGGACTGG 0: 1
1: 0
2: 1
3: 15
4: 175
969244944_969244954 12 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244954 4:5925841-5925863 CCAGGTGATGGAAGTTGGGAAGG 0: 1
1: 0
2: 0
3: 41
4: 374
969244944_969244949 -6 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244949 4:5925823-5925845 GGGATGAGCTGGAGTTCACCAGG No data
969244944_969244956 14 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244956 4:5925843-5925865 AGGTGATGGAAGTTGGGAAGGGG 0: 1
1: 0
2: 4
3: 51
4: 847
969244944_969244958 23 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244958 4:5925852-5925874 AAGTTGGGAAGGGGGTCTTAAGG 0: 1
1: 0
2: 1
3: 9
4: 178
969244944_969244955 13 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244955 4:5925842-5925864 CAGGTGATGGAAGTTGGGAAGGG 0: 1
1: 0
2: 2
3: 41
4: 409
969244944_969244957 15 Left 969244944 4:5925806-5925828 CCCACCCTTGGCAGCGGGGGATG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 969244957 4:5925844-5925866 GGTGATGGAAGTTGGGAAGGGGG 0: 1
1: 0
2: 5
3: 78
4: 739

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969244944 Original CRISPR CATCCCCCGCTGCCAAGGGT GGG (reversed) Intronic
901005069 1:6167647-6167669 CATGCTCCGCTGCCTTGGGTTGG - Intronic
901643052 1:10702714-10702736 CTTCCCCCGCTGGCAGGGGTGGG - Intronic
901652353 1:10750304-10750326 CTTGCCCTGCTGCCAAGGCTGGG + Intronic
902216161 1:14935722-14935744 CCTGCCCAGCTGCCAAGGGCTGG + Intronic
912438124 1:109676149-109676171 AATCCCCAGGTGTCAAGGGTGGG - Intronic
916868782 1:168889028-168889050 CAGCCCCCTCTGTCAAGGCTTGG + Intergenic
919491855 1:198213774-198213796 CAGCCACCTCTGTCAAGGGTGGG + Intronic
919729251 1:200902388-200902410 CACCTCCCGCAGCCAAGAGTAGG + Intronic
1063896376 10:10686512-10686534 AATCCCCAGGTGTCAAGGGTGGG + Intergenic
1065279504 10:24120333-24120355 CCTCCCCGTCTCCCAAGGGTGGG - Intronic
1066424893 10:35298320-35298342 CATTCCCTGGTGCCAAGAGTTGG - Intronic
1071307330 10:84310870-84310892 CATGCCCCGCTGCCCAGTGGTGG - Intergenic
1071454521 10:85835359-85835381 AATCCCCACATGCCAAGGGTGGG + Intronic
1073135025 10:101215689-101215711 CATCCCCCTCTCCCGAGGCTTGG + Intergenic
1073833226 10:107411003-107411025 AATCCCCCGGTGTCAAGGGAAGG + Intergenic
1073971851 10:109052765-109052787 AATCCCCCTGTGTCAAGGGTGGG + Intergenic
1075857009 10:125638173-125638195 CATCCCCCACTGCCAGAAGTGGG + Intronic
1076268185 10:129127218-129127240 GTTCCCCAGCTACCAAGGGTTGG - Intergenic
1076983408 11:217852-217874 CATCCCCATGTGTCAAGGGTGGG + Intronic
1077014030 11:392185-392207 CAGCCCTCTCTGCCAAGGGGAGG + Intergenic
1079729420 11:23921400-23921422 CAGCCACAGCTGCCAGGGGTGGG + Intergenic
1081981449 11:47269669-47269691 CTGCCCCCGCTGCCCAGGATTGG + Exonic
1083657704 11:64237605-64237627 CTTCCTCCGTTGCCAAGGGCGGG + Exonic
1086509578 11:87542474-87542496 AATCCCCATCTGTCAAGGGTAGG - Intergenic
1089457548 11:118634289-118634311 CCTCCCCTCCTGCCCAGGGTCGG - Intronic
1089593316 11:119559077-119559099 AATCCCCACCTGTCAAGGGTGGG - Intergenic
1089947862 11:122496107-122496129 AATCCCCAGGTGTCAAGGGTGGG - Intergenic
1092118948 12:6030391-6030413 CATCCCCTGCTGTCAATGGTGGG + Intronic
1098023870 12:66182640-66182662 CATCCCCCGCCCCCAAGTTTTGG - Intergenic
1099111894 12:78572287-78572309 AATCCCCACCTGTCAAGGGTGGG - Intergenic
1104900903 12:132189132-132189154 CATCCCCCGCTGGGCAGGGAGGG - Intergenic
1104942740 12:132402536-132402558 CATCCCCAGCTGCCCAGGTGAGG + Intergenic
1105541498 13:21320669-21320691 CATCCCCTTCTGCCAGGGGATGG - Intergenic
1108853713 13:54767569-54767591 AATCCCCATGTGCCAAGGGTGGG + Intergenic
1108951922 13:56105144-56105166 AATCCCCAGGTGCCCAGGGTGGG - Intergenic
1112851978 13:103717268-103717290 AATCCCCACATGCCAAGGGTGGG - Intergenic
1113440059 13:110321913-110321935 CATCCCCACATGTCAAGGGTGGG - Intronic
1114424645 14:22611766-22611788 CATCCCCGGCTGCCTAAGCTAGG + Exonic
1121576844 14:94995754-94995776 CATCTTCCGCTGCCAAGGATCGG + Intergenic
1124477336 15:30045875-30045897 CATTCCCTGCTGCCAGGGGTGGG - Intergenic
1129459570 15:75693758-75693780 CATGCCCCGCCTCCATGGGTTGG + Intronic
1130794499 15:87194562-87194584 CCTTCCCCGCAGCCAAAGGTAGG + Intergenic
1138229599 16:55327448-55327470 CCTCCCCCACTGCCAAGGTAGGG + Intronic
1138991258 16:62393011-62393033 CCTTCCCTGCTGCCAGGGGTGGG - Intergenic
1140772055 16:78214087-78214109 CATGCCCTGCTGCCTAGGGCTGG + Intronic
1141873180 16:86803610-86803632 CATCCCCCGAGGCCAAGGACTGG - Intergenic
1142258197 16:89025844-89025866 CATCCACCGCTGCCCTAGGTGGG + Intergenic
1145113953 17:20190803-20190825 CATCCCCCACCCCCAAGGGAGGG - Intronic
1145799646 17:27674686-27674708 CAGCCCTCCCTGCCCAGGGTAGG + Intergenic
1146757703 17:35448267-35448289 CTTCCCCCGTTGCGAAGGTTGGG - Intronic
1149449673 17:56739813-56739835 CATCCCCCACTCCCAAGCGTTGG + Intergenic
1149528892 17:57379324-57379346 CATCTCCCCCAGCCCAGGGTGGG - Intronic
1150698099 17:67423360-67423382 CATCCCCCTCTCCCAAGGTAAGG - Intronic
1150920427 17:69476794-69476816 CATCTCCCTCTGCCATTGGTTGG + Intronic
1151143873 17:72020704-72020726 CATCCCCACGTGTCAAGGGTGGG - Intergenic
1151674414 17:75590174-75590196 CCTTCCCCGGTGCCAAGGGCAGG + Intergenic
1152078502 17:78172516-78172538 CCTTCCCTGCTGCCAGGGGTGGG - Exonic
1160995668 19:1881001-1881023 CATCCCCAGCTGGCATGGGTGGG - Exonic
1164928019 19:32145724-32145746 CATCCCCCACTGGCAAGGGGGGG + Intergenic
1164940952 19:32251971-32251993 CAACCCCCGCTGACATGGTTTGG + Intergenic
1165106162 19:33470787-33470809 CATCCCATGCTGCCATGGGGTGG - Intronic
1165775099 19:38399522-38399544 CCTCCCCCGATGACAAGGCTGGG - Intergenic
1168122018 19:54256885-54256907 CACCCCCAGCTGCCCGGGGTTGG + Intronic
1168134090 19:54338790-54338812 CACCCCCAGCTGCCCAGGGGTGG + Intronic
1168598017 19:57694793-57694815 CGACCACAGCTGCCAAGGGTGGG - Intronic
1168599844 19:57708839-57708861 GAGTCCCCGCTGCCCAGGGTCGG - Intronic
926327507 2:11797941-11797963 AATCCCCAGGTGTCAAGGGTGGG + Intronic
927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG + Intronic
928474591 2:31613959-31613981 CATCCCCACATGTCAAGGGTGGG - Intergenic
929546853 2:42861528-42861550 CATCCCAGGAGGCCAAGGGTAGG - Intergenic
930601915 2:53453488-53453510 AATCCCTCGCTGCAAAGGGAAGG - Intergenic
933005183 2:76983350-76983372 AATCCCCAGGTGTCAAGGGTGGG + Intronic
941227547 2:162867856-162867878 CAGCCACCGCTTCCAAGGGGTGG - Intergenic
942461377 2:176171108-176171130 CAGCCTCTGCTGCCAGGGGTGGG - Intronic
944704885 2:202278892-202278914 CCTACCCCTCTGCCAAGGTTAGG - Intronic
945049478 2:205809437-205809459 CATTCCCCGCTGCCTAGTTTTGG - Intergenic
946863555 2:224022804-224022826 AATCCCCCTGTGCCAAGGGCAGG + Intronic
947623208 2:231604124-231604146 CCTCCACCGCTGCCTGGGGTTGG - Intergenic
948992305 2:241561328-241561350 CATCCTCGGCTGCCAGGGGCAGG + Intronic
1172073647 20:32277661-32277683 CATTCCCCGCTGCCCCGGATGGG - Exonic
1172292040 20:33783768-33783790 CTGCCCCCGCTGCCGTGGGTGGG - Exonic
1177570419 21:22878729-22878751 AACCCCCAGCTGTCAAGGGTGGG - Intergenic
1180731877 22:17988366-17988388 CATCCCCATCTGCCAGGGGTGGG + Intronic
1181032628 22:20155615-20155637 CCTCCTCCGCTGCCCAGGGATGG + Intergenic
1181786104 22:25228340-25228362 CGCCCCCCGCGCCCAAGGGTTGG + Intronic
1181818279 22:25456170-25456192 CGCCCCCCGCGCCCAAGGGTTGG + Intergenic
1184395309 22:44232467-44232489 AATCCCCAGGTGTCAAGGGTAGG + Intergenic
1184466116 22:44669500-44669522 TATCCCCACCTGCCAAGGGATGG - Intronic
1185128224 22:49023436-49023458 CAGCCCCCTCTGCCATGGGCTGG + Intergenic
949548899 3:5096229-5096251 CGCCCCCCGCTGCCTAGGGAAGG - Intergenic
951350561 3:21602231-21602253 AATCCCCAGGTGTCAAGGGTGGG - Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954393468 3:50279618-50279640 TATCCCCAACTGCCTAGGGTTGG + Intronic
954453681 3:50585543-50585565 CATCCCACCCAGCCAAGGCTTGG + Intergenic
955763493 3:62315224-62315246 AATCCCCCTGTGTCAAGGGTGGG - Intergenic
957900423 3:86481792-86481814 GATTCCCCCCTGGCAAGGGTTGG + Intergenic
960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG + Intronic
963229066 3:142891542-142891564 AATCCCCAGGTGTCAAGGGTGGG - Intergenic
964049943 3:152378745-152378767 CTTGCCCTGCTGCCCAGGGTGGG + Intronic
966733557 3:183170320-183170342 AATACCCCGCTTCCAAGGGCAGG - Intergenic
968901534 4:3434320-3434342 AATCCCCCGGTATCAAGGGTGGG - Intronic
969244944 4:5925806-5925828 CATCCCCCGCTGCCAAGGGTGGG - Intronic
969957394 4:10905084-10905106 CATCCCCACATGTCAAGGGTGGG + Intergenic
971252523 4:24985330-24985352 CATCCCCCACTGGCCAGGGGTGG - Intergenic
972382811 4:38535295-38535317 AATCCCCAGGTGTCAAGGGTGGG - Intergenic
986124275 5:4870518-4870540 AATCCCCACCTGTCAAGGGTGGG + Intergenic
986277478 5:6290384-6290406 AATCCCCACCTGTCAAGGGTGGG - Intergenic
986798224 5:11232851-11232873 AATCCCCAGATGTCAAGGGTAGG + Intronic
988140622 5:27234671-27234693 AATCCCCAGGTGTCAAGGGTGGG + Intergenic
992000362 5:72430288-72430310 CACACCCCTCTGCCCAGGGTGGG - Intergenic
992069229 5:73134831-73134853 CATCCTCTGGTGGCAAGGGTGGG - Intergenic
995186411 5:109276450-109276472 CATCCCCCAGTGCCAAGCTTGGG - Intergenic
996683919 5:126258808-126258830 AATCCCCATCTGTCAAGGGTGGG + Intergenic
1010480568 6:76347977-76347999 AATCCCCACGTGCCAAGGGTGGG + Intergenic
1010863253 6:80939400-80939422 CATCCCTCGCTGCCAGGGTGGGG + Intergenic
1011335887 6:86259303-86259325 TACCCCCTACTGCCAAGGGTGGG - Intergenic
1013948242 6:115748278-115748300 AATCCCCATCTGTCAAGGGTGGG - Intergenic
1016761420 6:147741631-147741653 CATGCGCCGTTTCCAAGGGTAGG + Intergenic
1017225465 6:152015994-152016016 AATCCCCAGGTGTCAAGGGTGGG + Intronic
1018099816 6:160427409-160427431 CTTCCCCCACTGTCCAGGGTTGG - Intronic
1019549764 7:1596108-1596130 AATCCCCAGCTCCTAAGGGTTGG - Intergenic
1020139567 7:5605201-5605223 CACCCTCCGCTGCCCAGGGTAGG + Intronic
1023684070 7:42717244-42717266 AATCCCCACATGCCAAGGGTGGG + Intergenic
1024074545 7:45811854-45811876 CCTCCCACGCTGACAAAGGTCGG + Intergenic
1025701193 7:63821747-63821769 AATCCCCAGGTGTCAAGGGTGGG - Intergenic
1026170457 7:67949392-67949414 AATCCCCAGGTGTCAAGGGTGGG - Intergenic
1029362161 7:100095646-100095668 CAGCCCCTGCTGCAAAGGGGAGG + Intronic
1030486678 7:110177507-110177529 AATCCCCCGGTTTCAAGGGTAGG + Intergenic
1030754564 7:113272368-113272390 AATCCCCAGGTGTCAAGGGTGGG - Intergenic
1034399330 7:150851751-150851773 CATCCCCCATTACCAAGGTTTGG - Intronic
1035839429 8:2794847-2794869 AATCACCTGCAGCCAAGGGTGGG + Intergenic
1036227448 8:6971650-6971672 CAGCCCCTGCTGCCATGGGAAGG + Intergenic
1036444367 8:8808826-8808848 CATCCCCCGCAAATAAGGGTTGG + Intronic
1039789016 8:40859272-40859294 CGTCACCAGCTGACAAGGGTGGG - Intronic
1041315667 8:56559576-56559598 CATCTCACACTGCCAAGGGCAGG + Intergenic
1042678865 8:71356712-71356734 CTTCCCCCCCTGACAAGGGGAGG - Intronic
1044944229 8:97375848-97375870 CATCCCCAGCTGCCAGGGTGAGG - Intergenic
1049444881 8:142625280-142625302 CTTCCGCCTCTGGCAAGGGTGGG - Intergenic
1055671228 9:78608046-78608068 AATCCCCACCTGTCAAGGGTGGG + Intergenic
1056147266 9:83744985-83745007 AATCCCCAGTTGTCAAGGGTGGG - Intronic
1056732353 9:89177649-89177671 GGACCCCCGCTGCCCAGGGTTGG + Intronic
1056880747 9:90391034-90391056 AATCCCCAAGTGCCAAGGGTGGG - Intergenic
1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG + Intronic
1059413539 9:114149275-114149297 CACCCCCAGCAGCCCAGGGTGGG - Intergenic
1059570909 9:115434611-115434633 GATCCCCATATGCCAAGGGTGGG + Intergenic
1059608415 9:115862199-115862221 CATCCCCTGCTGTCAATGGGAGG - Intergenic
1060013414 9:120064793-120064815 CATCCCCACGTGTCAAGGGTGGG - Intergenic
1061335751 9:129934394-129934416 TAACCCCCGCTGCCTAGGCTGGG + Intronic
1062095681 9:134702008-134702030 GATCCCCAGCTGCCCCGGGTGGG + Intronic
1062211751 9:135368300-135368322 CATCCCTGGCTGCCAGGAGTTGG + Intergenic
1186029114 X:5347597-5347619 CATCCGCATGTGCCAAGGGTGGG - Intergenic
1186262236 X:7791783-7791805 AATCCCCAGGTGTCAAGGGTGGG - Intergenic
1194558313 X:95389422-95389444 GATCCCCCGCTGGCTAGGCTAGG + Intergenic
1194823319 X:98531659-98531681 CATTCCCCTCTGGCTAGGGTTGG - Intergenic
1199205567 X:145145084-145145106 CATCCCCAGATGTCAAGGGCGGG - Intergenic
1199220198 X:145308783-145308805 AATCCCCCTGTGTCAAGGGTGGG - Intergenic
1199324970 X:146488604-146488626 AATCCCCAGATGTCAAGGGTGGG - Intergenic