ID: 969245134

View in Genome Browser
Species Human (GRCh38)
Location 4:5927039-5927061
Sequence TACGATGCCCACTGTGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969245134 Original CRISPR TACGATGCCCACTGTGGAAG GGG Intronic
902520495 1:17012990-17013012 AACGATCCCTATTGTGGAAGGGG + Intergenic
904862277 1:33547630-33547652 TCTGTTTCCCACTGTGGAAGAGG + Intronic
906820154 1:48920829-48920851 TACCATGCTGACTGTGGTAGTGG + Intronic
911143262 1:94528441-94528463 TTTGCTTCCCACTGTGGAAGGGG - Intergenic
912508732 1:110174237-110174259 GACCATTCCCACTGGGGAAGGGG - Intronic
913448004 1:118970368-118970390 TAGTATGCCCACAGTGGCAGTGG - Intronic
917466216 1:175278741-175278763 AATTATGCCCACTGTGGAAGGGG + Intergenic
923539015 1:234875012-234875034 AATTATGCCCACTGTGGAAACGG - Intergenic
924805145 1:247355975-247355997 CATGATTTCCACTGTGGAAGAGG + Intergenic
924860112 1:247911627-247911649 TACAATTCCCACTATCGAAGGGG + Intergenic
1070250116 10:74766127-74766149 TACAGGGCCCACTGTGGGAGGGG - Intergenic
1072826349 10:98610628-98610650 CACTGTGCCCACTGTGGAAAAGG + Intronic
1073403271 10:103276215-103276237 TGGGATGCCCACAGTGGCAGAGG - Intergenic
1074158020 10:110815096-110815118 TTCCCTGCCCCCTGTGGAAGGGG - Intronic
1074210894 10:111334012-111334034 TAGGATGGCCACTGTGGAGATGG + Intergenic
1076517525 10:131056481-131056503 TGAGACGCCCTCTGTGGAAGAGG + Intergenic
1078762032 11:14259401-14259423 CACGCTGCCCACTGAGGAAACGG + Exonic
1082156814 11:48831117-48831139 TTTGATGCCTACTGTGGAAAAGG + Intergenic
1082157133 11:48836692-48836714 TTTGATGCCTACTGTGGAAAAGG + Intergenic
1088556357 11:111065289-111065311 TACGATGTCCTCTGTAGCAGAGG - Intergenic
1092312967 12:7378232-7378254 TAGGATGCTCACTGTGGAGCTGG - Intronic
1095058166 12:37643748-37643770 TTTGATGCCTACTGTGGAAAAGG - Intergenic
1101503108 12:105322148-105322170 TACTTTGTCCACAGTGGAAGAGG - Intronic
1104074401 12:125376735-125376757 TATGAAGCCCACTGTCTAAGGGG + Intronic
1114001215 14:18249665-18249687 TTCGAGGCCTACTGTGGAAAAGG - Intergenic
1116726514 14:48567026-48567048 TACACTCCACACTGTGGAAGCGG + Intergenic
1130545939 15:84857726-84857748 TCTGACACCCACTGTGGAAGTGG + Exonic
1134785614 16:16939994-16940016 TCCCATGCCCACTTTGGAATGGG + Intergenic
1136078299 16:27832000-27832022 GAAAATGCCCACTGAGGAAGGGG - Intronic
1137036201 16:35572096-35572118 TACAATGCCCTCTGTGGGAAGGG + Intergenic
1140433105 16:74921725-74921747 TACGCTGACAATTGTGGAAGAGG + Intronic
1147422354 17:40328174-40328196 TGCCAAGGCCACTGTGGAAGAGG - Intronic
1156028770 18:32688825-32688847 TAGGAGGGCCACTGTGGAAGAGG + Intronic
1158792049 18:60793422-60793444 TAACATGCCCACTGAAGAAGGGG - Intergenic
1164293638 19:23889643-23889665 TCCAAGGCCCTCTGTGGAAGGGG - Intergenic
1164348938 19:27308025-27308047 TATGAGGCCTACTGTGGAAAAGG + Intergenic
1165481219 19:36065662-36065684 TAGGATACCCACTGCGGCAGAGG + Intronic
929050582 2:37833441-37833463 TAAAATGGCCACTGTGGAAATGG + Intergenic
938784131 2:134609947-134609969 TACGAGGCCTACAGGGGAAGGGG + Intronic
940146574 2:150551456-150551478 TAGGAAGCCCACAGTGGCAGGGG + Intergenic
947998058 2:234545021-234545043 AAGGATCCCCAGTGTGGAAGCGG + Intergenic
948022193 2:234743793-234743815 TCAGAAGGCCACTGTGGAAGAGG - Intergenic
1169931485 20:10837724-10837746 CACGATGCCCACAGTGCAAGGGG + Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1176266942 20:64214588-64214610 CACGGTACCCACTGTCGAAGAGG + Intronic
1179116172 21:38494474-38494496 TAAGATTCCCTCTGTGGGAGTGG - Intronic
1180425726 22:15180463-15180485 TTCGAGGCCTACTGTGGAAAAGG - Intergenic
1180506021 22:16005106-16005128 TTCGAGGCCTACTGTGGAAAAGG - Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1182524641 22:30907671-30907693 TACAATGCCCACTGGAGAGGCGG + Exonic
1182744928 22:32598155-32598177 TTCGGTGCCCACAGTGTAAGAGG - Intronic
1203330929 22_KI270738v1_random:87875-87897 TTTGATGCCTACTGTGGAAAAGG - Intergenic
1203332636 22_KI270739v1_random:16941-16963 TTCGAGGCCTACTGTGGAAAAGG + Intergenic
955857961 3:63294912-63294934 TACCATGCCTACTTTGGAAATGG + Intronic
958691831 3:97479345-97479367 TACAATGCCCATTCTGTAAGTGG - Exonic
961746310 3:129065529-129065551 TACGGTGCCTATTATGGAAGTGG + Intergenic
966057221 3:175709100-175709122 TACGATGGCCCCTGTAGAACTGG - Intronic
969245125 4:5926968-5926990 TATGGTGCTTACTGTGGAAGGGG + Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969326603 4:6447884-6447906 TACGATTCTCACTGTGGGAAAGG - Intronic
970018679 4:11541451-11541473 TGAGATGCACACTGTGGAAGTGG - Intergenic
975183455 4:71373774-71373796 TAGGATTGCGACTGTGGAAGTGG + Intronic
980186295 4:129465123-129465145 TAGGATGCCCACAGTGGATTGGG - Intergenic
989944355 5:50200751-50200773 TTCGATGCCTACTTTGGAAAAGG - Intergenic
992016085 5:72576644-72576666 AACTATGGCCATTGTGGAAGAGG - Intergenic
1010791995 6:80075498-80075520 CACGTTGCCCCCTGGGGAAGTGG - Intergenic
1014813276 6:125908324-125908346 TAACATGCCCACAGTGGCAGGGG + Intronic
1017441842 6:154471856-154471878 TATGATGGCCACTATGGAACTGG - Intronic
1017542675 6:155418674-155418696 GACGCTTCCCACTGAGGAAGTGG + Intronic
1018529038 6:164743504-164743526 TAACATGCCCAATGTGAAAGGGG + Intergenic
1020967371 7:14888387-14888409 TAAGATGCCCAGTAAGGAAGAGG - Intronic
1023337285 7:39183573-39183595 TATAATCCCCAATGTGGAAGAGG - Intronic
1028241257 7:88423848-88423870 AAGGATGGTCACTGTGGAAGTGG + Intergenic
1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG + Intronic
1030471309 7:109965726-109965748 TTAGATGTCCACTGTTGAAGTGG + Intergenic
1033474819 7:141681823-141681845 TCCAATGCCCACTGTAGATGTGG + Intronic
1033813248 7:145042787-145042809 TACGATTCACAATGTGGTAGAGG - Intergenic
1034527465 7:151674679-151674701 TAGGATGCCCTCTTTGGAAGGGG - Intronic
1035140526 7:156755299-156755321 TACTTTTCCTACTGTGGAAGGGG + Intronic
1039878077 8:41604521-41604543 TACCATCACCACTGTGGAGGGGG - Intronic
1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG + Intronic
1047813443 8:128435608-128435630 TAGGAGGCCCACTGGGGAAAAGG - Intergenic
1054276034 9:63071377-63071399 TTCGAGGCCTACTGTGGAAAAGG - Intergenic
1054398799 9:64693552-64693574 TTCGAGGCCTACTGTGGAAAAGG + Intergenic
1203379835 Un_KI270435v1:24238-24260 TTCGAGGCCTACTGTGGAAAAGG + Intergenic
1197093521 X:122567308-122567330 TATCATGCCCACTATGGTAGAGG + Intergenic
1201264666 Y:12194189-12194211 TCCAATCCCCAGTGTGGAAGGGG + Intergenic
1202080685 Y:21081056-21081078 CACAATTCCCACTGTGGAAAGGG - Intergenic