ID: 969250341

View in Genome Browser
Species Human (GRCh38)
Location 4:5964004-5964026
Sequence ATGTGCAACTAGAAAAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969250338_969250341 -10 Left 969250338 4:5963991-5964013 CCAAACCTGCAGTATGTGCAACT 0: 1
1: 0
2: 0
3: 13
4: 173
Right 969250341 4:5964004-5964026 ATGTGCAACTAGAAAAGCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969250341 Original CRISPR ATGTGCAACTAGAAAAGCTA GGG Intronic
906768558 1:48460679-48460701 ATGTGCTACTAGAAATAATAGGG + Intronic
906772078 1:48494252-48494274 TTGTGTAGCTAGAACAGCTAGGG - Intergenic
907342314 1:53744568-53744590 ATGAGCTACTAGAGAAGCTGAGG + Intergenic
908467282 1:64409107-64409129 ATGTGTATCTAAAAAACCTATGG - Intergenic
910675836 1:89815766-89815788 AATTGAAACTAGAAAAACTAAGG - Intronic
911886420 1:103305887-103305909 ATGTGAAACAATAAAAACTAAGG - Intergenic
913576746 1:120182874-120182896 ATCTGCAACAATAAAAGCTTTGG + Intergenic
914080540 1:144407022-144407044 ATGTGCACCTAGGGAGGCTATGG - Intergenic
914175447 1:145275546-145275568 ATGTGCACCTAGGGAGGCTATGG - Intergenic
914530168 1:148517022-148517044 ATGTGCATCTAGGGAGGCTATGG - Intergenic
914558654 1:148794309-148794331 ATCTGCAACAATAAAAGCTTTGG + Intergenic
914614181 1:149335921-149335943 ATCTGCAACAATAAAAGCTTTGG - Intergenic
915912184 1:159922271-159922293 ATGTGCAGCTTGATAAGCTGGGG - Intronic
916079038 1:161220808-161220830 ATGTGGGACTAGAAAAACTTTGG - Intergenic
916150068 1:161779392-161779414 ATGTCATACTAGAAAAACTAAGG - Intronic
916561829 1:165940396-165940418 ATGTACAACCAAAAAAGCTCAGG + Intergenic
919321952 1:196054162-196054184 ATGTACAAATAGAAAAATTAAGG - Intergenic
921505300 1:215960940-215960962 ATTTACAAATAAAAAAGCTAAGG - Intronic
1063006687 10:1978485-1978507 ATGTGAAAGTAGCAAAACTAAGG - Intergenic
1064934113 10:20660923-20660945 ACCTGCAACTTGAAAAGCAATGG + Intergenic
1065156072 10:22871302-22871324 ATGTGCACCAAGAGAAGCTCTGG - Intergenic
1068131567 10:52901685-52901707 ATGTGCAACAATAAATGATAAGG - Intergenic
1068439685 10:57035406-57035428 ATGTAAACATAGAAAAGCTACGG + Intergenic
1071746029 10:88420499-88420521 ATCTGAAACTAGAAGAGCTATGG - Intronic
1074268178 10:111926682-111926704 CGGTGCAACTAGGAAAGCTTAGG + Intergenic
1074619086 10:115099079-115099101 ATTGGCAACTAGAAAAGGGAGGG - Intronic
1075931201 10:126297685-126297707 AAAAACAACTAGAAAAGCTAGGG + Intronic
1076551849 10:131284465-131284487 ATGTGCAAATATACAACCTAAGG + Intronic
1078393387 11:10956081-10956103 CTGTGCACCTGGAAAAGCAATGG - Intergenic
1078747414 11:14128558-14128580 CTGTGTACCTGGAAAAGCTATGG - Intronic
1080467442 11:32510938-32510960 CTGTAAAACTAGAGAAGCTATGG + Intergenic
1080897854 11:36461094-36461116 ATGGGCAGCTAGAAGAGCAAGGG + Intronic
1088525732 11:110751912-110751934 GAGTGCAAATAGAAAATCTAAGG - Intergenic
1089427353 11:118389989-118390011 ATGTGAAAATAGAAAAGAAATGG + Intronic
1089673765 11:120074984-120075006 ATGTGCAATTAGCAAGGCCAAGG + Intergenic
1091561181 12:1614817-1614839 ATGTGGATTTAGAAAAGCTCTGG - Intronic
1091968054 12:4762211-4762233 GTGTGGAAATAAAAAAGCTAGGG - Intronic
1095736916 12:45567766-45567788 CTGTGCAAATTGAGAAGCTATGG + Intergenic
1096275540 12:50204420-50204442 ATGTGAAAAGAGAACAGCTAGGG + Intronic
1098460829 12:70731314-70731336 ATGTACAAATAGGAAAGCAATGG + Intronic
1102454294 12:113062204-113062226 TTGGGAAACTAGCAAAGCTAGGG - Intronic
1104105505 12:125655030-125655052 ATGTGGAATTAGAAAAGATTTGG + Exonic
1106775110 13:33001460-33001482 ATGTGCAACTGGAGAAGTGAGGG - Intergenic
1106928207 13:34634996-34635018 AGATGTAACTTGAAAAGCTATGG - Intergenic
1111051151 13:82884309-82884331 ACCTGTACCTAGAAAAGCTATGG - Intergenic
1112937048 13:104813930-104813952 CTGAGTAACTAGAAAAGTTATGG - Intergenic
1115542056 14:34430086-34430108 ATGTGCAACAAAACAAGGTATGG - Intronic
1117608005 14:57451679-57451701 ATTAGCAAATTGAAAAGCTAAGG - Intergenic
1118070938 14:62245996-62246018 CTGTGCACCTGGAAAAGCCAGGG + Intergenic
1118181604 14:63499322-63499344 CTGTGAAACTAGAAGGGCTATGG + Intronic
1119604637 14:76004204-76004226 CTGTGCTACCAGAAATGCTAAGG - Intronic
1120026239 14:79587630-79587652 ATGTATAAATAGAAAAGCCAAGG + Intronic
1122166994 14:99833893-99833915 CTGTCCAACTAGAAAATCGAAGG - Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1129464415 15:75715951-75715973 AGGTGAAACTAGGAGAGCTACGG - Intergenic
1129720831 15:77877061-77877083 AGGTGAAACTAGGAGAGCTACGG + Intergenic
1130162194 15:81413142-81413164 ATGTGCATCTGTAACAGCTACGG - Intergenic
1130808260 15:87350254-87350276 ATGTGCAACTAGAAACCACAAGG - Intergenic
1130976179 15:88776997-88777019 ATTTGCAAATTGAAAAGCCACGG + Intergenic
1131668517 15:94595486-94595508 AGGGACAACTAGAAAAGCTTTGG + Intergenic
1140607242 16:76553644-76553666 TTGAGCACCTAGAAAAGATATGG - Intronic
1142973780 17:3630953-3630975 TTGAGGAACTAGCAAAGCTAAGG + Intronic
1150276797 17:63903552-63903574 ATCTGCAATTTGGAAAGCTATGG - Intergenic
1160842753 19:1153950-1153972 ATGTGCTTCTTGAAAAGCTGGGG + Intronic
1161733540 19:5977190-5977212 TTGTGCAACTAGAAAAGGGGGGG + Intronic
1162000317 19:7740614-7740636 AACAACAACTAGAAAAGCTATGG + Exonic
925260358 2:2523358-2523380 CTGTGGAACTAGAAAGGCTAAGG - Intergenic
925378675 2:3408051-3408073 ATGTGGAACTAGCAGAGCCAGGG - Intronic
928118244 2:28563487-28563509 TTGTCCATGTAGAAAAGCTAAGG + Intronic
928652540 2:33418166-33418188 ATGTGCAGATAGAATATCTATGG + Intergenic
932123144 2:69119421-69119443 ATGTGCAACAGGATAAGCCATGG + Intronic
932159934 2:69450466-69450488 ATGTACAACTAAAAGAGTTAGGG + Intergenic
933969636 2:87459810-87459832 TTGTGTAATCAGAAAAGCTAAGG + Intergenic
934135764 2:88995034-88995056 ATGTGCATATTGAAAGGCTAGGG + Intergenic
934234551 2:90218741-90218763 ATGTGCATATTGAAAGGCTAGGG - Intergenic
936324150 2:111490687-111490709 TTGTGTAATCAGAAAAGCTAAGG - Intergenic
936744116 2:115553312-115553334 ATGAGCAAGAAGAATAGCTATGG - Intronic
938949676 2:136244846-136244868 GTGTGCAGCTTGAAATGCTAAGG - Intergenic
941321332 2:164058982-164059004 CTTTGCAAATAGAAAAGCTAAGG + Intergenic
943084070 2:183291056-183291078 ATGAGCAACTTGAATAGATAAGG + Intergenic
943889101 2:193263116-193263138 ATGTGCAACTATAAAAACACAGG - Intergenic
948401084 2:237685933-237685955 ATTTGCAACTAGAAAAACACTGG - Intronic
1170820081 20:19750168-19750190 ACATGCAACTTGAAAAGTTAAGG + Intergenic
1172548717 20:35782205-35782227 ATGTGCAACTTGTAAAGGCAAGG + Intronic
1177986668 21:27983958-27983980 ATGTGAGACAAGAAAAGCAAAGG + Intergenic
1178038860 21:28616756-28616778 ATGAGAAACTAGAATAGCAAAGG - Intergenic
949160308 3:874332-874354 TAGTGCTATTAGAAAAGCTAGGG - Intergenic
950464242 3:13143867-13143889 TTATGCAACTAAAAAATCTAAGG - Intergenic
951636579 3:24785216-24785238 TTGTACAAATAGAAAAGATAAGG + Intergenic
952457655 3:33488840-33488862 ATGTTCATGTAGAATAGCTAGGG + Intergenic
952745671 3:36775520-36775542 ATGGGCAACAAGAATAGCTCTGG + Intergenic
953179910 3:40585392-40585414 ATGTGCAAAGAGAAAAGAAAAGG - Intergenic
954891160 3:53930303-53930325 AAGTGCAAATACAAAAGCCAAGG - Intergenic
955113974 3:55978478-55978500 TTTTACAACTAGAAAAGCAACGG + Intronic
956003045 3:64749461-64749483 ATGTGCAATAGGAAAAGCTTTGG + Intergenic
959237536 3:103744134-103744156 ATGTCCAAGTAGAAATGCCAAGG + Intergenic
960426726 3:117517338-117517360 ATGTTCAACTAATATAGCTAGGG - Intergenic
963316606 3:143765394-143765416 ATATGCTACTAGAAAAGATGGGG + Intronic
963928765 3:150979581-150979603 ATGCGCATCTAGAACAGTTATGG - Intergenic
963933579 3:151029165-151029187 ATGTAAAACTGGAAAAGGTATGG + Intergenic
964046104 3:152329122-152329144 ATGTGGAACTGGAAGTGCTAGGG + Intronic
964154801 3:153572102-153572124 ATTTGCAATTAAAAAAACTAAGG - Intergenic
965251054 3:166344373-166344395 CTGTCCAATTAGAAATGCTAAGG + Intergenic
967997314 3:195176595-195176617 ATGAGGAACTGGAGAAGCTAGGG - Intronic
969250341 4:5964004-5964026 ATGTGCAACTAGAAAAGCTAGGG + Intronic
972186263 4:36532059-36532081 TTCTGCAAGTAGAAAAGGTAAGG - Intergenic
973718388 4:53700181-53700203 CTGTGCACCTGGAAAAGCCACGG - Intronic
976364756 4:84221150-84221172 GTGTACAGCAAGAAAAGCTAAGG + Intergenic
977522399 4:98101417-98101439 ATGGGCAAGTAGAAAACTTAGGG - Intronic
978413934 4:108455673-108455695 ATGAGCAACTGGTAAAGCTTAGG - Intergenic
978905680 4:114002796-114002818 ATGGATAACTAGTAAAGCTACGG - Intergenic
979535521 4:121815822-121815844 ATGTCATAATAGAAAAGCTAGGG - Intronic
979559198 4:122083162-122083184 ATGTGGAATTAGAAGATCTAGGG + Intergenic
981042471 4:140236164-140236186 ATGTGTGTTTAGAAAAGCTAGGG + Intergenic
982200518 4:152955956-152955978 ATGTGCAAAGAGAAAACCTGAGG - Intronic
982445053 4:155481081-155481103 ATGTGGAAATAGAAAAAATAAGG + Intergenic
982888556 4:160817823-160817845 ATGAGCATCAAGAAAAGCTTAGG - Intergenic
983020414 4:162669730-162669752 CTGTGCACCTGGAAAAGCCATGG - Intergenic
984574472 4:181431355-181431377 ATGTGCTAACAGAAATGCTAGGG - Intergenic
985338588 4:188922945-188922967 ATTTGAAACTATAAAAGTTATGG + Intergenic
987443007 5:17980522-17980544 ATGTGCAATGAGAAAAGCTTTGG - Intergenic
987726338 5:21704716-21704738 ATCTGGAAGTAGATAAGCTAAGG + Intergenic
988037968 5:25852131-25852153 ATGTGCTACTAGAAAAACCTTGG + Intergenic
988687195 5:33536566-33536588 AAGTGAAACTACACAAGCTATGG - Intronic
988873501 5:35417526-35417548 ATGTGGAAAGAGAAAAGTTATGG - Intergenic
990833068 5:59982471-59982493 ATGTGCCCCTAGACAATCTAAGG - Intronic
994947296 5:106411983-106412005 ATGTGCAACCAGAAAATATCAGG - Intergenic
995976065 5:118035920-118035942 ATTTGAAACTATGAAAGCTATGG - Intergenic
996157140 5:120115647-120115669 CTGTGAACCTGGAAAAGCTATGG + Intergenic
996924119 5:128802730-128802752 ATGTGCAAATAAATAAGGTAAGG + Intronic
996933869 5:128925200-128925222 ATGTGCTACTAAATAAGATATGG + Intronic
1005334195 6:24776446-24776468 ATGTGCAAACAAAAAAGCTTAGG - Intronic
1006884203 6:37366912-37366934 ATGTGCAGCTGGGATAGCTATGG - Intronic
1006928019 6:37669511-37669533 ATGAGCAAATTGAAAAGCCAAGG - Intronic
1008243498 6:49142605-49142627 ATGTGAAAAGAGAAAAGCTGAGG + Intergenic
1012594528 6:101024017-101024039 ATGTGCAACTTGAAAGCCTGAGG + Intergenic
1012666873 6:101982191-101982213 ATCTGCAACCACAAAAGTTAAGG - Intronic
1014984661 6:127988663-127988685 ACTTGCTATTAGAAAAGCTATGG - Intronic
1015936623 6:138411367-138411389 ATGTGCAACTTGATAAGATCTGG - Intronic
1018584693 6:165344498-165344520 ATGTGGACCTAGAAGAGGTAAGG - Intronic
1020355685 7:7273240-7273262 AGAAGCAACTGGAAAAGCTAGGG + Intergenic
1020576501 7:9937687-9937709 ATAAGCAACTAGAAAAGTTAAGG - Intergenic
1021581639 7:22160373-22160395 ATTTACTACTAGAAAAGCTAAGG + Intronic
1024035936 7:45507260-45507282 ATTTGCAACTAAAAGAACTAGGG - Intergenic
1026425146 7:70283960-70283982 ATATGCAATTAGATAAACTACGG - Intronic
1026435736 7:70395835-70395857 ATGTTCAGATAGAAAAGCTGAGG - Intronic
1026558476 7:71428416-71428438 ATGTCCACCAAGAAAAGCAATGG - Intronic
1028292759 7:89087892-89087914 ATGTTCAATTAGAAAATCTCTGG + Intronic
1028952302 7:96650224-96650246 ATGGGCATCTTGAAAAACTAAGG + Intronic
1031338829 7:120573176-120573198 ATGTGCAACTTTAACTGCTATGG - Intronic
1031491289 7:122392790-122392812 TTGTGCAAGTAGAAAACCTTTGG - Intronic
1032099498 7:128962057-128962079 TTGACCAACTAAAAAAGCTAGGG + Intronic
1032698593 7:134359123-134359145 CTGTGTAACTGGAAAAGCTAAGG - Intergenic
1034751003 7:153569087-153569109 CTCTGCATCTAGAAAAGCCAGGG - Intergenic
1039234940 8:35491910-35491932 ATGGGCAAAAGGAAAAGCTAAGG - Intronic
1039420966 8:37439975-37439997 CTGTGCTACAAGAAATGCTAAGG - Intergenic
1045621006 8:103978328-103978350 GTGTGTAACTAGACAATCTAGGG + Intronic
1048461155 8:134622990-134623012 ATGTGTGACTAGAGAAGCTAAGG - Intronic
1051500127 9:17767711-17767733 ATGTGGAAATGGAAAAGCTCTGG - Intronic
1054735438 9:68745525-68745547 ATGTGCATCTCCAAGAGCTAAGG - Intronic
1055119263 9:72639848-72639870 ATGAACAACGAAAAAAGCTATGG - Intronic
1058776596 9:108290310-108290332 AAGTGCAACTATAAGAGCCAGGG + Intergenic
1059670540 9:116487221-116487243 ATGTGCAACTTGAGATTCTAAGG - Intronic
1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG + Intergenic
1188059157 X:25579094-25579116 ATATCCCACTACAAAAGCTAAGG - Intergenic
1191053219 X:56216471-56216493 ATGCTCTACTGGAAAAGCTAAGG - Intergenic
1191191647 X:57674502-57674524 ATGTGCAAGTAGGAAAGATATGG - Intergenic
1193641525 X:84014734-84014756 ATGTGCAACTGGAAGGGCCAGGG + Intergenic
1193766850 X:85540110-85540132 ATGTTTTACTAGAAAAGCCAGGG - Intergenic
1194042245 X:88956156-88956178 ATGTGCAAGTAGGAGAGATATGG + Intergenic
1195572611 X:106413379-106413401 ATGTGAAAAAAGAAAAGATAGGG + Intergenic
1195618676 X:106932389-106932411 ATCCTCAACTAGAAAAGCCAGGG + Intronic
1196043303 X:111229414-111229436 ATTTGCAATAAGAAAAGCAATGG + Intergenic
1196070243 X:111512949-111512971 ATATGCAATTAGAAAACCAAAGG + Intergenic
1199044045 X:143147819-143147841 CTGTGCACCTGGAAAAGCTGCGG + Intergenic
1199235465 X:145487621-145487643 ATTTGCAACCAGCAAAGCTATGG - Intergenic
1200679605 Y:6194564-6194586 CTGTGCACCTGGAAAAGCTGCGG - Intergenic
1201752922 Y:17453591-17453613 CTGTGCAACTGCAAAAACTACGG - Intergenic