ID: 969252786

View in Genome Browser
Species Human (GRCh38)
Location 4:5980649-5980671
Sequence AGAGTCCCAGAATAACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969252782_969252786 5 Left 969252782 4:5980621-5980643 CCGGAGGTGGGTGTTGGGGAGGG 0: 1
1: 0
2: 7
3: 104
4: 658
Right 969252786 4:5980649-5980671 AGAGTCCCAGAATAACAGCCTGG 0: 1
1: 0
2: 0
3: 29
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969252786 Original CRISPR AGAGTCCCAGAATAACAGCC TGG Intronic
904129639 1:28266194-28266216 GGGGCCCCAGCATAACAGCCAGG - Intronic
904316981 1:29671856-29671878 AGAATCCCAGCATCTCAGCCCGG - Intergenic
904688497 1:32276551-32276573 AGAGTCCCAGGACAGCTGCCTGG + Intronic
905021959 1:34823940-34823962 TGAGTCCCTGAATGACTGCCTGG + Intronic
905271027 1:36787517-36787539 AGAGTCCCAGGAACACAGCTGGG + Intergenic
905942488 1:41875092-41875114 GGAGAGCCAGAATACCAGCCTGG + Intronic
906681202 1:47726541-47726563 AGAGTCCTAGAATCACAGGATGG + Intergenic
908740644 1:67323835-67323857 GCAGTCCCAGAATGACAGCTGGG + Intronic
911052891 1:93686694-93686716 AGAGTGCCTGAGTAACTGCCTGG + Intronic
911433510 1:97824642-97824664 AGAGCCACAGAAAAACGGCCAGG + Intronic
912023506 1:105138084-105138106 AGAGGCCCAGATAAACAGCCTGG - Intergenic
912373714 1:109193222-109193244 AGATTTCCATAATAACAGGCTGG - Intronic
912725171 1:112052833-112052855 GCAGGCCCTGAATAACAGCCAGG - Intergenic
913347324 1:117821276-117821298 AGAGGCCCAGATAAACAGCCTGG - Intergenic
915555708 1:156659664-156659686 ACAGTGCCAGAATAGCTGCCAGG + Intergenic
916375260 1:164146946-164146968 AGAGTCCCAGAATGACCAACAGG - Intergenic
916637305 1:166686636-166686658 AGAGTCCTAGAAGAAAACCCAGG - Intergenic
919649545 1:200132899-200132921 TGAGTCCCAGAACATCAGCATGG + Intronic
920155575 1:203947761-203947783 AGAATCACAAAATACCAGCCAGG - Intergenic
920862922 1:209725571-209725593 AAAGTCCCACAATGACAGCTGGG - Intronic
921608792 1:217186742-217186764 ACAGTCCCAGATGAACTGCCAGG + Intergenic
1063100413 10:2945317-2945339 AGGGTCCCAGAGTCAGAGCCAGG + Intergenic
1067229486 10:44396629-44396651 AGAGTCCCAGGACAAGAGCCAGG + Intergenic
1069799381 10:71072727-71072749 AGAGTCCCAGCAGAGCAGCCTGG - Intergenic
1069821859 10:71233412-71233434 TGTTGCCCAGAATAACAGCCCGG + Intronic
1072440207 10:95447558-95447580 AGAGCCCCAGAATAAATGCCTGG + Intronic
1072454139 10:95561387-95561409 TGAGTCCCAGAAAAACAGAGCGG - Intronic
1073253696 10:102137587-102137609 AGAGTCACAGATTAAAACCCGGG - Intronic
1074186178 10:111101151-111101173 AAAGGGCCAGAAAAACAGCCCGG + Intergenic
1074723134 10:116280966-116280988 TGAGTCCCAGGATGACTGCCTGG + Intergenic
1080012778 11:27474531-27474553 AGAGTACCAGATTAGGAGCCAGG - Intergenic
1080233702 11:30045726-30045748 AGAGACCCAGATAAACAGCCTGG + Intergenic
1083559079 11:63657471-63657493 CAACTCCCAGAACAACAGCCAGG + Intronic
1084115907 11:67042906-67042928 AGCTTCCCAGCTTAACAGCCTGG + Intronic
1084926875 11:72520884-72520906 AAAGTGCCAGAATTACAGGCGGG + Intergenic
1087224084 11:95578649-95578671 AGAGTCTCAGAAACACAGCTGGG + Intergenic
1089739254 11:120571117-120571139 GAAGTCCCAGGAAAACAGCCGGG - Intronic
1090282478 11:125468201-125468223 AGAGTCTCACAATATCACCCAGG + Intronic
1091190894 11:133694508-133694530 AGAGTTCAAGAACAACAGCAAGG + Intergenic
1091982991 12:4881686-4881708 AGAGCTCCGAAATAACAGCCGGG - Intergenic
1093417833 12:18940853-18940875 TGAGTCGCAGAACAACAGCCTGG + Intergenic
1096168494 12:49446518-49446540 AGAATCCCAGGCCAACAGCCAGG - Intronic
1096730676 12:53609618-53609640 AGAGTCCCAGTCTATCACCCAGG - Intronic
1096944830 12:55392598-55392620 AGAGTCCCAGGTCTACAGCCCGG + Intergenic
1097497771 12:60363609-60363631 AGAGTCCCAGCCAAAGAGCCAGG - Intergenic
1100125867 12:91424109-91424131 AGAGAACCAAAATAACATCCTGG - Intergenic
1102610178 12:114105096-114105118 AGAGTCCCAAAATGGCAGCAGGG - Intergenic
1102794442 12:115676247-115676269 AGAGTCCTAGATTAAAGGCCAGG - Intergenic
1106452006 13:29890688-29890710 TGAGTCCCAGAATTAAAGACTGG - Intergenic
1106945845 13:34827096-34827118 AGAGTCCCATAATTACTGCCAGG + Intergenic
1107894511 13:44947702-44947724 AGAATCCCATAAAAACAGGCTGG - Intronic
1109341985 13:61074415-61074437 AGAGACCCAAAATGACAACCTGG + Intergenic
1115036807 14:28867732-28867754 GGAGTCCCAGAATGCCAGCTGGG - Intergenic
1117005855 14:51420171-51420193 AGAGTCCCTGAATAACTGCATGG + Intergenic
1117331846 14:54720472-54720494 TGAGTCCCACAAAAACAGCCAGG - Intronic
1119808882 14:77499856-77499878 AAAGTCCCAGAAGGACAGCCGGG + Intergenic
1122718694 14:103710068-103710090 AGGGTCCCCGGATGACAGCCAGG + Intronic
1126953751 15:53911254-53911276 AGAGGCCCAGATAAATAGCCAGG + Intergenic
1129530720 15:76262307-76262329 AGAGTCCCAGAACAAAAGTGAGG + Intronic
1137548231 16:49418645-49418667 GGAGTCCTAGAAGAACAGCATGG - Intergenic
1138281266 16:55773675-55773697 AGCGTCCCAGTTTCACAGCCAGG + Intergenic
1138287273 16:55820186-55820208 AGCGTCCCAGTTTCACAGCCAGG - Intronic
1138550607 16:57745952-57745974 AGAGGCCCAGGATGACAGCTGGG - Intronic
1142713447 17:1735800-1735822 AGGGCCCCAGAACAACATCCTGG - Intronic
1142756589 17:2019924-2019946 AGCATGCCAGAATAACAGCAAGG - Intronic
1144623052 17:16830591-16830613 AGCGTCCCTGGAGAACAGCCTGG - Intergenic
1144883378 17:18442125-18442147 AGCGTCCCTGGAGAACAGCCTGG + Intergenic
1145148851 17:20502261-20502283 AGCGTCCCTGGAGAACAGCCTGG - Intergenic
1146506564 17:33410663-33410685 AGAGTCCAAGACTAACAGAAAGG - Intronic
1147194236 17:38754591-38754613 AGAGTCAGAGAATGACATCCTGG + Intronic
1148044498 17:44734482-44734504 AAAGTTCCAGAATAGCAGCCTGG - Intronic
1148948669 17:51289016-51289038 AGATTCCCAGAAGAAAAGCCAGG + Intronic
1150585742 17:66516302-66516324 AGAGACCCAGAAAATGAGCCAGG + Intronic
1152293416 17:79453514-79453536 AGAGTCCCAGGATAACAGAGGGG + Intronic
1154094865 18:11403647-11403669 AGAGTACCAGAAGAACAGAAAGG + Intergenic
1154485559 18:14868861-14868883 AGAGTCCCAGCATCACTTCCTGG - Intergenic
1156585577 18:38427430-38427452 AGAGACCCAGGATCACAGCATGG + Intergenic
1156997213 18:43482633-43482655 AGAGGCCCAGATAAACATCCTGG + Intergenic
1158226329 18:55205302-55205324 TGAGTCACAAAATAACAGCTTGG - Intergenic
1159963811 18:74576981-74577003 AGAATACCGGAATAGCAGCCGGG + Exonic
1160811109 19:1013271-1013293 AGAGGCCCTGAATGACAGCCAGG - Exonic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1162393235 19:10402394-10402416 AGAGTCCCTGGATAAGAGCAGGG + Intronic
1162915724 19:13873412-13873434 TGAGGCCCAAAATAACCGCCTGG - Intronic
1163175915 19:15564017-15564039 TGAGGCCCAGAAAAAGAGCCCGG - Intergenic
1164649014 19:29878884-29878906 AGAGTCCTGGAATTACAGGCTGG + Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1165737359 19:38185159-38185181 AGTGACACAGAATGACAGCCTGG - Intronic
1167066568 19:47190680-47190702 AGGGTCCCAGAGAAACAGCGGGG + Intronic
1167894100 19:52567212-52567234 AAAGTGCCAGAATTACAGGCGGG + Intronic
929432413 2:41898270-41898292 AGAGTCCCAGAGAAAGACCCCGG + Intergenic
929760493 2:44802299-44802321 ACAGTCCAAGAAAAACAGCTCGG + Intergenic
931046151 2:58355829-58355851 AAAGTCCCAAAATAAGAGACTGG + Intergenic
933751975 2:85608729-85608751 AGAATTCCAGAATATCAGGCTGG + Exonic
935557730 2:104528603-104528625 AGATTCCCAGAAAGACAGACAGG - Intergenic
935976840 2:108586651-108586673 TGAGTCCCAGCAGAACATCCTGG - Intronic
941806612 2:169716761-169716783 AGAGGCCCAGATAAACAACCTGG - Intronic
942913490 2:181274621-181274643 AGAGTCACAGAGTCACTGCCTGG + Intergenic
944615659 2:201457018-201457040 AGTCTCCCAGAAAAAAAGCCAGG + Intronic
945175417 2:207038786-207038808 AGAGTCCCAGAATCTTGGCCGGG - Intergenic
946142386 2:217702733-217702755 AGAGTCCCAAAATAGCAGAGAGG - Intronic
1170697596 20:18673765-18673787 AGAGTCCCACAAAACCACCCTGG + Intronic
1171026116 20:21632084-21632106 ACATTCCAAAAATAACAGCCTGG - Intergenic
1171992739 20:31708944-31708966 TGAGTCCCAAAATAACAACCAGG + Intronic
1174226070 20:49001333-49001355 AGAGTCCCAGAGTGAGGGCCGGG - Intronic
1176795775 21:13370615-13370637 AGAGTCCCAGCATCACTTCCTGG + Intergenic
1177652021 21:23969332-23969354 AGAGGCCCAGAAAAGCAGCCTGG - Intergenic
1179480849 21:41677700-41677722 TGAGCCCAAGAATACCAGCCTGG + Intergenic
1179950757 21:44707669-44707691 GGAGTCCCAGAGTGACCGCCTGG + Intronic
1181144523 22:20835028-20835050 TGAGCCCCAGAATAAGATCCTGG + Intronic
1183132254 22:35849948-35849970 AGAGGCAGAGAATGACAGCCAGG + Intronic
1183235227 22:36611721-36611743 ACAGTGCTAGAACAACAGCCTGG - Intronic
1183524774 22:38316834-38316856 AGCGTCCCCAAATCACAGCCGGG + Intronic
1183965433 22:41438985-41439007 AGAATCCCAAAATAACAATCTGG - Intronic
1184461356 22:44639984-44640006 AGGGTCCCAGAACACCAGCAGGG + Intergenic
1184461367 22:44640021-44640043 AGGGTCCCAGAACACCAGCAGGG + Intergenic
1184461445 22:44640243-44640265 AGGGTCCCAGAACACCAGCAGGG + Intergenic
1185279749 22:49964977-49964999 AGAGTCCCTGATAAACAGCCCGG + Intergenic
949710693 3:6867053-6867075 GGAGTTCCAGAATATCAGCAGGG - Intronic
953963832 3:47286780-47286802 AGGCTCCCAAAATAACAGCCAGG - Intronic
955465859 3:59236534-59236556 ACAGTCCCTGAAAAACAGGCTGG - Intergenic
955835379 3:63048751-63048773 AGGCTCTCAGACTAACAGCCTGG - Intergenic
956067400 3:65411768-65411790 AGAAACCCAGAATAATATCCGGG + Intronic
959968286 3:112380637-112380659 ACTGTCCCAGAATAGTAGCCAGG + Intergenic
960241213 3:115344059-115344081 ATTTTCCCAGAATAAGAGCCAGG - Intergenic
960534624 3:118802603-118802625 AGAGGCTCAGATAAACAGCCTGG - Intergenic
961951192 3:130751139-130751161 TGTGTCCCCGAATCACAGCCTGG + Intergenic
962669705 3:137692725-137692747 AGATTCCTAGAAGAACAGGCTGG - Intergenic
963644910 3:147901861-147901883 AGAGCACCAGAAGAACAGACTGG - Intergenic
964695280 3:159500818-159500840 AAAGTTCCAGAATAACAGTTTGG - Intronic
967232146 3:187349971-187349993 AAAGGCCCAAAATAACAACCAGG + Intergenic
969252786 4:5980649-5980671 AGAGTCCCAGAATAACAGCCTGG + Intronic
970263985 4:14260886-14260908 AGAGTCGAAGAAGGACAGCCAGG - Intergenic
974357252 4:60828800-60828822 ACAGCCTCAGAACAACAGCCTGG + Intergenic
974951948 4:68593342-68593364 AGAGTCCCTGAAGAGCAGCTTGG - Intronic
975763049 4:77636426-77636448 AGAGGCCTAGATAAACAGCCTGG - Intergenic
976317151 4:83670759-83670781 ATAGTGCCAGAAAAACAACCTGG + Intergenic
981350985 4:143729395-143729417 AGAATCACAGAATTACAGCTAGG + Intergenic
982516447 4:156356521-156356543 AGAATCCTAGAATAAAAGCTTGG - Intergenic
986939658 5:12935530-12935552 AGAGGCCCAGATAAACAGCCTGG + Intergenic
987005284 5:13704046-13704068 AGGGTCCCAGAGTAACTGTCTGG + Intronic
988501487 5:31787562-31787584 AGAGTCTCAAAATAGCTGCCAGG + Intronic
990702100 5:58484748-58484770 AGAGTCACAGAATATTAGCAGGG + Intergenic
992818494 5:80469611-80469633 AGAGTCCTAGAAGAAGAGACTGG - Intronic
993539706 5:89133708-89133730 AGAGTCCTAGAAACAGAGCCAGG - Intergenic
997698260 5:135878376-135878398 AGAGTGACTGAATAACAGCCAGG - Intronic
1001729590 5:173941608-173941630 AAAGTCCCAGGGTTACAGCCTGG - Intronic
1002126150 5:177045871-177045893 AGAGTCCCAGGTTTAAAGCCTGG + Intronic
1002332713 5:178455526-178455548 AGAACCCCAGAATCTCAGCCTGG + Intronic
1007123368 6:39401958-39401980 TGACTCCCAAAATACCAGCCAGG - Intronic
1007313016 6:40961655-40961677 AGGGTCCCAGAAGAACAGAGAGG - Intergenic
1008866171 6:56213078-56213100 AGAGTCACAGAATATCAGACTGG - Intronic
1009456251 6:63860009-63860031 AGAGGCACAGAATAACATCTGGG - Intronic
1009909193 6:69904758-69904780 GGAGGCCCAGATAAACAGCCTGG - Intronic
1010305576 6:74317844-74317866 ATAGCCCCACAATAACATCCTGG + Intergenic
1010498657 6:76567296-76567318 AGAGGCCCAGAAGAACAGAATGG - Intergenic
1011549186 6:88513828-88513850 AGAATCAGAGAATAACAGTCTGG - Intergenic
1014141027 6:117942224-117942246 AGAATCCCAGAACAAGAGCATGG - Intronic
1014245376 6:119062447-119062469 TGAGCCCTGGAATAACAGCCTGG + Intronic
1014664789 6:124223406-124223428 AGAGTCCCAGAATAAGGGAAAGG + Intronic
1014940178 6:127429045-127429067 AGAGTCCTAGAAAATAAGCCTGG + Intergenic
1019294434 7:266469-266491 TGAGTCCCAAAAGGACAGCCTGG - Intergenic
1021793986 7:24234805-24234827 AGAGTCTCAGAATGGGAGCCAGG + Intergenic
1023914657 7:44579861-44579883 AGAGTCCAAGAAAAACAGGTAGG + Intronic
1024581618 7:50805358-50805380 AGAGACTCAGAATGACAGCCTGG + Intergenic
1024966343 7:55025382-55025404 AGAATCCCAGATTGACACCCAGG + Intronic
1026310970 7:69183954-69183976 TGAGTCCCAGAATCACTGCATGG - Intergenic
1029180951 7:98701456-98701478 AGAGTCCCAGAAAACCATGCTGG - Intergenic
1030695790 7:112583285-112583307 AGAGTCCCACAATGTCACCCAGG - Intergenic
1031265759 7:119578138-119578160 AAAGCCCCAGAATATCAGACAGG + Intergenic
1031753719 7:125611940-125611962 AGAGTCCCAGGAACACATCCTGG + Intergenic
1032693122 7:134309554-134309576 AGAGGGCCAGAATAACAGCGTGG + Intronic
1034139568 7:148803219-148803241 AGAGTCCCAGTATAGAAGCCAGG + Intergenic
1034290383 7:149926446-149926468 AGAGTCCCAGAAGGAAAGCAAGG - Intergenic
1034660690 7:152766395-152766417 AGAGTCCCAGAAGGAAAGCAAGG + Intronic
1035026643 7:155830850-155830872 AGAATTCCAGATTTACAGCCTGG - Intergenic
1037819721 8:22129877-22129899 AGAGTCCCAGGACAACTGCAGGG + Intronic
1041004232 8:53483754-53483776 GGAGGCCCAGATAAACAGCCTGG + Intergenic
1045299420 8:100898470-100898492 ACAGGCCCGGAAGAACAGCCAGG + Intergenic
1046701287 8:117403818-117403840 AGGGTCCCAAAATACCATCCAGG + Intergenic
1046845470 8:118910490-118910512 TGAAACCCAGAATGACAGCCAGG + Intergenic
1046885729 8:119364888-119364910 GGAGTCCCTGAATAACAGCTTGG - Intergenic
1047231912 8:123004800-123004822 TGAGTCCCTGAATAACTGCATGG + Intergenic
1048214723 8:132483577-132483599 AGATTCCCAGAATGACAGTTTGG + Intergenic
1048615295 8:136067433-136067455 ATTGTCCCAGAATCACACCCAGG - Intergenic
1049050356 8:140189903-140189925 CCAGTCCGGGAATAACAGCCAGG + Intronic
1051408558 9:16765574-16765596 AGAGTCACAGAATCACCACCTGG + Intronic
1052482545 9:29049789-29049811 AGAGTCTCAGAAGAACAGTAGGG + Intergenic
1053067365 9:35078140-35078162 AGAGACCCTGAATGGCAGCCAGG - Exonic
1053886481 9:42647730-42647752 AGAGTCCCAGCATCACTTCCTGG - Intergenic
1054225500 9:62455179-62455201 AGAGTCCCAGCATCACTTCCTGG - Intergenic
1055514794 9:77023602-77023624 ATAGTCCCAGAATAACAGAGAGG - Intergenic
1057250984 9:93501642-93501664 ACAGGCACAGAATGACAGCCAGG + Intronic
1059090237 9:111348865-111348887 AGACTCCCAAATTAACTGCCTGG + Intergenic
1185717136 X:2351909-2351931 AGGGTTCCACCATAACAGCCAGG + Intronic
1185720366 X:2376436-2376458 ACACTCCCAGAACAAGAGCCTGG + Intronic
1186621716 X:11248167-11248189 TGGGTCCCTGAATAACGGCCTGG + Intronic
1188406317 X:29814679-29814701 AGAGTCCCAGAAGAAAACCTAGG - Intronic
1189966197 X:46376410-46376432 AGAGGCACAGAGTAACAGCCTGG + Intergenic
1190596948 X:52060590-52060612 AGAGTCCCAGAATGTCAGTGTGG + Intergenic
1190611876 X:52193483-52193505 AGAGTCCCAGAATGTCAGTGTGG - Intergenic
1193021376 X:76797176-76797198 ATAGGCCCAGATAAACAGCCTGG + Intergenic
1199192671 X:144989678-144989700 AAAGTACCAGAATAACAGCTAGG + Intergenic
1200207483 X:154327782-154327804 AGAGACTCAGAATAACATGCAGG - Intronic