ID: 969252819

View in Genome Browser
Species Human (GRCh38)
Location 4:5980990-5981012
Sequence TTGTGGGAAGTGTGGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969252819 Original CRISPR TTGTGGGAAGTGTGGCAAAA TGG Intronic
902254215 1:15177067-15177089 TAGTGGGGATTGTGGCAAAGTGG + Intronic
902471322 1:16648891-16648913 GTTTGAGAAGTGTGGCAAGAGGG + Intergenic
902487485 1:16758554-16758576 GTTTGAGAAGTGTGGCAAGAGGG - Intronic
902837885 1:19058458-19058480 TGGAGGGAAGTGTGGCCCAAAGG - Intergenic
903575626 1:24337906-24337928 TTGGGGAAACTGAGGCAAAAGGG + Intronic
903983281 1:27205395-27205417 ATGTGGTAAGTGTTACAAAAGGG + Intergenic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904795538 1:33053556-33053578 TTGGGGGAAGGGTGGAGAAAGGG + Intronic
905007087 1:34718456-34718478 TAGTGGGAAGTGTGGGAGAGTGG - Intronic
907287164 1:53389364-53389386 TGGGGGGAAGTGTGGGAGAAAGG + Intergenic
907829108 1:58047393-58047415 TGGTGTGAAGTGTGGCACCAGGG + Intronic
909130816 1:71734646-71734668 TTTAAGGAAGTGTGGCAATAAGG - Intronic
909388320 1:75086633-75086655 TTGTGGGAAGTGGAGGAAGAGGG + Intergenic
910498621 1:87862783-87862805 TTGGTGTAAGTGTGCCAAAATGG - Intergenic
912774510 1:112497033-112497055 TTGTGGGAAGTGTGTCTGGAAGG - Intronic
913047335 1:115085631-115085653 TCGTGGGAAGTTTGGGAAAGGGG - Intronic
913201723 1:116500135-116500157 TGGTGGGGACTGTGGCAAACTGG - Intergenic
914405443 1:147366608-147366630 TTCTGGGAAGTATCCCAAAAAGG - Intergenic
914430190 1:147613634-147613656 GTGTCTGAAGTCTGGCAAAATGG - Intronic
914454878 1:147826642-147826664 TTGGGGGAAGCGTGGGAAGAGGG - Intergenic
916657006 1:166885199-166885221 TTGTGGTTATTGTGGCAAAATGG - Intergenic
916859388 1:168786614-168786636 TTGTGGGAATTGTGGTAAGTTGG + Intergenic
917215405 1:172673046-172673068 CTGTTGGAAATGTGGCAAAGAGG - Intergenic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
919507569 1:198418755-198418777 GTGAGAGAAGTTTGGCAAAAGGG + Intergenic
920301929 1:204994263-204994285 TTCTGCCAAGTGTGGCAGAAAGG - Intronic
921065392 1:211619016-211619038 TTGTGAGAACTGTGGCAGGAGGG - Intergenic
921331367 1:214041054-214041076 TTGTGGGGAGGGTGGGAAAGGGG + Exonic
923583404 1:235241125-235241147 TTGAGGAAAGTGTAGTAAAAAGG + Intronic
924950277 1:248875907-248875929 TGGTGGTAAGTTTGGTAAAATGG + Intergenic
1063211448 10:3884658-3884680 TCGTGGGAAAGGGGGCAAAATGG + Intergenic
1063805886 10:9639862-9639884 TGGTGGGAAGGGTGGCAGGATGG + Intergenic
1068467127 10:57408861-57408883 TTGTGGAAAGATAGGCAAAATGG + Intergenic
1069450876 10:68516688-68516710 TTGTGGAAAGTGGGCAAAAAAGG - Intronic
1070127791 10:73635870-73635892 TGGGGGGAAGTGTGGCCAAAAGG + Intronic
1070496748 10:77031386-77031408 TGGTGGGAACTGTGGCACATTGG - Intronic
1070578575 10:77700474-77700496 TTCTGGGAATTGTATCAAAAAGG - Intergenic
1070716820 10:78728598-78728620 TTGTGGGAAGCCTGTCAAAGGGG - Intergenic
1071962224 10:90818144-90818166 TGGTGGGAGGTGGGGCCAAATGG + Intronic
1072567081 10:96625672-96625694 TTGTTGGAGGTGTGGCAAAAGGG - Intronic
1075313610 10:121434405-121434427 GGCTGGGAAGTGTGGCAGAAGGG - Intergenic
1077992211 11:7422241-7422263 TTGTTGGAAGTGGGGCAGGAAGG + Intronic
1078350143 11:10586196-10586218 TTGTGGGTAGGGTGGCAAGTGGG + Intronic
1078937007 11:15960840-15960862 TTGTTGGGAGTGGGGCACAAGGG + Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080624520 11:34016441-34016463 TTGTGGGAGGGGGAGCAAAATGG + Intergenic
1081657997 11:44869986-44870008 TTGGGGGAAGTGTGGCACTGCGG - Intronic
1081712096 11:45224076-45224098 TTGGGGCAAGTGTTGCAAAGGGG - Intronic
1081877662 11:46420838-46420860 TTGTAGGGAATGGGGCAAAAGGG + Intronic
1084723375 11:70924150-70924172 TGGTGGGGAGTGTGGCAGGAGGG - Intronic
1084997418 11:72994988-72995010 TTGTTGGAAGTGGGGAGAAATGG - Intronic
1085969624 11:81571599-81571621 TTGTGGGAACTCTGGAAATACGG + Intergenic
1086111662 11:83205845-83205867 TAGTGGGAACTGTGGCAAACTGG - Intronic
1086235199 11:84621822-84621844 TTGGGGGAAGGGTGGCAGGAGGG + Intronic
1087345250 11:96964097-96964119 TTGTGGGAGGTGGAACAAAATGG + Intergenic
1087582166 11:100071219-100071241 TTTTGGGAAGTGAGTGAAAATGG + Intronic
1088477351 11:110256024-110256046 TTGTGTGTAGGGTGGTAAAACGG - Intronic
1088692298 11:112338324-112338346 CTGTGGGAAGTTTGGCAACAAGG - Intergenic
1088801338 11:113310020-113310042 TTCTGGGAAGTGTCCCCAAAAGG - Intergenic
1089725479 11:120474659-120474681 TTTTGGGGAGAGTGGCAAAAGGG + Intronic
1089937523 11:122379547-122379569 TGGGGGGAAGTGTGGGAAAAAGG + Intergenic
1092149427 12:6236849-6236871 TTGGGGGCAGTCTGGCAAGAGGG - Intronic
1094783680 12:33821381-33821403 TTGTGGGAGGTGGGGCCTAATGG - Intergenic
1097576104 12:61394479-61394501 TTCTTGGAATTGTGGCAAAAAGG + Intergenic
1098311709 12:69155345-69155367 TGGTGGGGACTGTGACAAAATGG + Intergenic
1100065961 12:90645579-90645601 TGGTGGGAACTGTGGCAACCTGG - Intergenic
1100990686 12:100248272-100248294 TTGAGGAAACTGAGGCAAAAAGG + Intronic
1101758161 12:107637751-107637773 TGGTGGGGACTGTGGCAAATCGG + Intronic
1102060902 12:109930332-109930354 TTGGGGGAAGGGTGGCATATGGG + Exonic
1102610180 12:114105104-114105126 TTGTAGGAAGAGTCCCAAAATGG - Intergenic
1102664790 12:114562788-114562810 TTGTGGGAAGTTTGGGAAGGAGG + Intergenic
1103043934 12:117719580-117719602 TGGTGGGGAGTGGGGCAAACTGG - Intronic
1103201998 12:119095353-119095375 GTCTGGCAAGTGTGGGAAAAAGG + Intronic
1104066612 12:125312016-125312038 TGGTGGGGACTGTGGCAAAGTGG + Intronic
1108465380 13:50709785-50709807 TAGTGAGGACTGTGGCAAAAAGG + Intronic
1110491859 13:76118654-76118676 TGGGGGGATGTGTGGCAAGATGG - Intergenic
1111668266 13:91296818-91296840 GTGTTGGAAGTGGGGCCAAATGG + Intergenic
1114029259 14:18561551-18561573 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1114173500 14:20297952-20297974 TTGTGGGGAGAGTGGCAGGAGGG + Intronic
1114191329 14:20441482-20441504 AAGTGGGAACTGTGGCAAACTGG - Intergenic
1115677823 14:35700039-35700061 TTGGGGGAGGTGTGGGAAAGTGG - Intronic
1116470317 14:45279213-45279235 TTGTAGAAAGTGTAGCATAATGG - Intergenic
1118542466 14:66843146-66843168 ATGAGTGAAGTGAGGCAAAAAGG - Intronic
1118844453 14:69536440-69536462 ATGTGGGAAGTGTGGATGAAGGG - Intergenic
1119638629 14:76297022-76297044 TTGTGTAAAGTGCTGCAAAATGG + Intergenic
1120734133 14:88034571-88034593 TGGTAGGAACTGTGGCAAATAGG - Intergenic
1120840507 14:89081170-89081192 TTGTGGGGAGGGCAGCAAAAAGG - Intergenic
1121113710 14:91329499-91329521 GTGTGGGAAGTGCTGCAAGAGGG - Intronic
1121727018 14:96159831-96159853 TGGTGGGGACTGGGGCAAAACGG + Intergenic
1123770311 15:23522117-23522139 TTTTGGGAAGTGGGGCTTAATGG - Intergenic
1125213746 15:37245233-37245255 TTTTGAGGAGTGTGGTAAAATGG + Intergenic
1125818609 15:42608268-42608290 TTGTGGGTAGTGTGGCTTGAGGG + Intronic
1126640047 15:50815257-50815279 TGTTGGCAAGTTTGGCAAAATGG - Intergenic
1127128390 15:55836058-55836080 GTGTGTGAAGTCTGGCAATAAGG - Intronic
1128426753 15:67549405-67549427 TTGTGTTAAATGTGGCATAATGG + Intronic
1128893465 15:71351780-71351802 TTGGGAGAAGTGTTGCAGAAAGG - Intronic
1129820053 15:78594264-78594286 TTGTGGGAAATGTGGACAAGAGG - Exonic
1130610896 15:85360112-85360134 TGGTGGGAAGTGGGGCAGATGGG + Intergenic
1131673342 15:94645717-94645739 TTGTGGGCAGAGTGGCAGAGTGG + Intergenic
1133848353 16:9478335-9478357 TGGTGGGGACTGTGGCAAACTGG - Intergenic
1134664686 16:16010375-16010397 TGGTGGGGACTGTGGCAAACTGG - Intronic
1138241616 16:55431902-55431924 TGGTGGGGAGTGTGGCTAATTGG + Intronic
1138435122 16:56994278-56994300 TTAGGGGAAGGATGGCAAAAGGG + Intronic
1138532694 16:57643447-57643469 CTGTGGGAAGAGTGACAAAGGGG - Intronic
1138865219 16:60810041-60810063 ATGTGTGAACTGTGGCAAGAGGG + Intergenic
1139435410 16:66934065-66934087 ATGTGGGAAGTGAAGGAAAAGGG + Exonic
1140053676 16:71505599-71505621 TGGTGGGGGGTGTGGCAGAATGG + Intronic
1140532883 16:75682462-75682484 GGGAGGGAAGTGTTGCAAAACGG + Intronic
1141667717 16:85474496-85474518 TTGTGGGAAGTGCCGCAGAGAGG - Intergenic
1141789053 16:86220771-86220793 TTTTGGGAAATGTTGCAACAGGG + Intergenic
1141835617 16:86537168-86537190 TTGTGGGAAATTTGGGAAGAAGG + Intronic
1143359130 17:6353256-6353278 TTGTGGGGAATGTGGAAACATGG + Intergenic
1144050962 17:11496803-11496825 TGGTGGGCACTGTGGCAAACTGG + Intronic
1144077150 17:11729649-11729671 TTGAGGGGAGGGTGGCAGAAGGG + Intronic
1144219065 17:13083698-13083720 TTGTGGGAAGTGAGGTATCATGG - Intergenic
1144836245 17:18158094-18158116 TGGTTGGAGGTGTGGCCAAATGG + Intronic
1146027918 17:29338803-29338825 TTGTGTGTAGTGTTGGAAAAGGG - Intergenic
1149375414 17:56038984-56039006 TTGTGGGCAATGTAGCAAGATGG - Intergenic
1150139335 17:62715317-62715339 TGGTGGCATTTGTGGCAAAATGG - Intronic
1150841463 17:68610841-68610863 TTGTTGGAAGTGGGGCCTAATGG + Intergenic
1152301215 17:79496082-79496104 TTTTGGAAAGTGGAGCAAAATGG + Intronic
1153181353 18:2438363-2438385 TTGTGGCTACTGTGGGAAAAAGG + Intergenic
1153519497 18:5938418-5938440 TTGTTGGAAGGGTCGCCAAAGGG + Intergenic
1154277977 18:12978657-12978679 TTGTGAGCAGTGTGAAAAAAAGG + Intronic
1157804459 18:50647882-50647904 TTGGGGGAAGTGAGTCATAAAGG - Intronic
1158185568 18:54767724-54767746 TTGTGTGAATTGTGGGAAACAGG - Intronic
1158903279 18:61986356-61986378 TAGTGGGAAGTGGGGTAGAAAGG - Intergenic
1159561604 18:70001103-70001125 TTTTAGGAAGAGTGGCAAAAGGG + Intergenic
1159887914 18:73927090-73927112 TGGTGGGAAGGGTGGCAAAGGGG + Intergenic
1160106287 18:75980882-75980904 TTGTAGGAAGTGGGAAAAAAAGG - Intergenic
1160243870 18:77141937-77141959 TTGTGGGGGGAGGGGCAAAAGGG - Intergenic
1160332634 18:78009347-78009369 GTGTGGGAAGTCTGGCAAGCTGG - Intergenic
1163008322 19:14409956-14409978 CTCTGGGAAGTGTCGCACAAAGG - Intronic
1164252253 19:23489065-23489087 TGGGGGGAAGAGTGGGAAAAAGG + Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1167399875 19:49258033-49258055 CTGTTGCAAGTGTGGTAAAAAGG + Intergenic
1167412834 19:49355272-49355294 TTGTGGGACGTGGGGGCAAAGGG - Intronic
1168523867 19:57073489-57073511 GGGTGGGGAGTGTGGAAAAAAGG - Intergenic
1202703721 1_KI270713v1_random:5686-5708 GTTTGAGAAGTGTGGCAAGAGGG + Intergenic
925501793 2:4513072-4513094 ATGTGGGTAGTGAGGAAAAACGG + Intergenic
926645456 2:15285967-15285989 TTGGGGGAAGTGTGAGGAAAAGG - Intronic
928925409 2:36573856-36573878 TGGCGGGAGGTGTGGGAAAATGG + Intronic
929355881 2:41023908-41023930 TGGTGGAAAGTGAGGCATAATGG - Intergenic
929406642 2:41650034-41650056 TGGTGGGAACTGTGGCAAACTGG + Intergenic
929974950 2:46624167-46624189 CTGTGCGATGTGTGGAAAAAAGG + Exonic
930007066 2:46906424-46906446 TAGAGGGCAGTGTGGCAGAAGGG + Intronic
931905665 2:66840370-66840392 TTGTTGGAAGACTGGCAAGAAGG - Intergenic
932674546 2:73767784-73767806 TTGTAGGAACTGAGGCATAATGG - Intronic
935077339 2:99757877-99757899 ACGTGGGAAATGTGGCACAAAGG - Intronic
935092659 2:99911196-99911218 TTGTAGGAAATGTGGCACTATGG + Intronic
938902957 2:135813902-135813924 TTGTGGGAAGTAGGGGCAAAAGG + Intronic
939687255 2:145214261-145214283 TTGTGGGATGGCTGGCCAAATGG - Intergenic
941369548 2:164647189-164647211 CAGTAGGAAGTGTGGCAAACTGG - Intergenic
941983205 2:171482956-171482978 TTGTGGGCAGTGTAACAAACAGG + Exonic
942827682 2:180199597-180199619 TTGTAGGTAGTGAGGCAGAATGG + Intergenic
942843775 2:180398110-180398132 TTGTGGAAAATGTGTCAAGATGG + Intergenic
943430588 2:187796193-187796215 TTGTGAGAAGTGTACCAAGAGGG + Intergenic
944069056 2:195649910-195649932 TTGAGGGTAGTGTGGTACAAAGG - Intronic
946352860 2:219166866-219166888 TTGTGGGAAGTGTAACCAAAGGG - Intronic
948287103 2:236794484-236794506 TTGTTGGAAATGTGGGAAAGGGG + Intergenic
1169805922 20:9559012-9559034 GTGAGGGCAGTGTGGGAAAATGG - Intronic
1170449136 20:16463703-16463725 TTCTGGGAAGTTTACCAAAAAGG - Intronic
1172105109 20:32512188-32512210 TGGTGGGGACTGTGGCAAAATGG - Intronic
1172311923 20:33925109-33925131 TTGTGGCCAGTGTGGCCACATGG - Intergenic
1172413899 20:34748394-34748416 TTGTGGGAAGGCTGGGATAAAGG + Intronic
1173191225 20:40876914-40876936 TTGTGGGAGGTGTGCAAACAGGG - Intergenic
1173283025 20:41646157-41646179 TGGTGGGAAGTGTGGTATCAAGG + Intergenic
1173572414 20:44085974-44085996 AGGTGAGAAGTGTGGGAAAATGG + Intergenic
1173623397 20:44453696-44453718 TGGTGGGGACTGTGGCAAACGGG + Intronic
1173950114 20:46985665-46985687 TGGTGGGGACTGTGACAAAATGG + Intronic
1173959574 20:47060655-47060677 TGGTGGGGACTGTGGCAAACTGG - Intronic
1174428049 20:50447334-50447356 TGGTGGGGACTGTGGCAAACGGG - Intergenic
1174540609 20:51286317-51286339 TGGTGGGGACTGTGGCAAACTGG - Intergenic
1174945574 20:54981479-54981501 GTGTGGTGACTGTGGCAAAATGG - Intergenic
1175028476 20:55928776-55928798 TTGCGGGAAGTCGGGGAAAAGGG + Intergenic
1175050468 20:56151041-56151063 TAGTGGGGAGTGTGGCAAAGTGG - Intergenic
1178598769 21:33978016-33978038 AGTTAGGAAGTGTGGCAAAAAGG + Intergenic
1178666862 21:34555625-34555647 TGGTGGGAAGTGTGGGAAGGAGG + Intronic
1180128111 21:45805539-45805561 TTGTGGGCAGTGTGGCAGAACGG + Intronic
1180453375 22:15488614-15488636 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1180758330 22:18178899-18178921 CTGTTCGAAGTATGGCAAAATGG - Intergenic
1180768618 22:18362691-18362713 CTGTTCGAAGTATGGCAAAATGG - Intergenic
1180810418 22:18757011-18757033 CTGTTCGAAGTATGGCAAAATGG + Intergenic
1180826493 22:18865915-18865937 CTGTTCGAAGTATGGCAAAATGG - Intergenic
1182064873 22:27423568-27423590 TGGTGGGGACTGTGGCAAACTGG + Intergenic
1182672269 22:32006180-32006202 TGGTGGGGACTGTGGCAAACTGG + Intergenic
1184220093 22:43094503-43094525 TGGTGGGAAGTGGGGGAGAAGGG - Intergenic
1203230236 22_KI270731v1_random:103579-103601 CTGTTCGAAGTATGGCAAAATGG - Intergenic
1203276636 22_KI270734v1_random:91821-91843 CTGTTCGAAGTATGGCAAAATGG - Intergenic
949356198 3:3182794-3182816 TGGTGGGAAGTGTGGGAAGAGGG - Intergenic
950811275 3:15651937-15651959 ATGTGGGAAGTGTTGTACAACGG - Intergenic
954114857 3:48460941-48460963 TGATGGGAAGTGGGGCCAAATGG + Intronic
954298110 3:49685350-49685372 GTTTGAGAAGTGTGGCAAGAGGG - Exonic
955487645 3:59450721-59450743 CTGTGGAAAATGTGTCAAAAAGG - Intergenic
956470024 3:69556741-69556763 TGGTGGGAACTGTGGCAAACTGG + Intergenic
957132230 3:76238049-76238071 TTATGGGTACTATGGCAAAAAGG + Intronic
957222722 3:77404696-77404718 TTATAGGAAATTTGGCAAAATGG + Intronic
958150337 3:89685062-89685084 TTATGGGCAGTGTGGGAGAAAGG + Intergenic
959025277 3:101233709-101233731 ATGTGGGAACTGTGGCAGGATGG - Intronic
959438470 3:106347061-106347083 TTGATGGGAGTGTGGCAAAGGGG - Intergenic
960493068 3:118340934-118340956 CTGTGAGAAGTGGGGAAAAAAGG + Intergenic
960738956 3:120811567-120811589 TTTTGGGAAGTGAGGCTAAGGGG + Intergenic
961087006 3:124076750-124076772 TGGTGGGGACTGTGGCAAACTGG + Intergenic
961108109 3:124259538-124259560 TTGTGGGAACTGAGGCACAGAGG + Intronic
961469484 3:127102264-127102286 TGGTGGGGACTGTGGCAAACTGG + Intergenic
963344201 3:144074283-144074305 TTGAGGAAAGTGAGGAAAAAGGG + Intergenic
963543007 3:146618197-146618219 TTGAGGAAAGTGTGTCAAGAAGG - Intergenic
963972606 3:151446209-151446231 TTGTTGAAAGTGTGGTGAAATGG + Exonic
964181964 3:153899077-153899099 TAATGGAAAGTGTGACAAAAAGG + Intergenic
964439355 3:156689931-156689953 TAGTGTGAAGTGTGGCACAAAGG - Intronic
964880629 3:161419190-161419212 TTGTGGGAAGTGAAGCCAATGGG - Intergenic
965237670 3:166147224-166147246 TTGTGGTAAGTGTTACAAAGGGG - Intergenic
965290872 3:166878094-166878116 TTGTGGGATCTGTGGCTATAGGG - Intergenic
965634348 3:170766391-170766413 TGGTGACAAGTGTGGCCAAAGGG - Intronic
965856375 3:173092973-173092995 TTGTGGAAAGTGCTACAAAAAGG - Intronic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
969208170 4:5664783-5664805 TGGTGGGAAGTGAGGCAGAAAGG - Intronic
969252819 4:5980990-5981012 TTGTGGGAAGTGTGGCAAAATGG + Intronic
969267958 4:6077931-6077953 TGGTGGGGACTGTGGCAAACTGG - Intronic
970001138 4:11367308-11367330 TTGTGGAAAGTGCTGCACAAAGG - Intergenic
970838663 4:20441165-20441187 ATGTGGTCAGTGTGGCAAAAGGG + Intronic
971150479 4:24026209-24026231 TGGTGGGAAGTGGGGCCAACTGG - Intergenic
972969333 4:44553110-44553132 GAGTGGGAATTGTAGCAAAAAGG - Intergenic
974867181 4:67595644-67595666 TAATAGTAAGTGTGGCAAAAGGG - Intronic
975585649 4:75945770-75945792 TTCTGGGAAATGTTACAAAAGGG - Intronic
976347085 4:84016580-84016602 GTGTGGGAAGTGGAGAAAAAGGG - Intergenic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977692726 4:99933699-99933721 TTGTGGGAATTCTGGAAAAAAGG + Intronic
979184491 4:117771774-117771796 TTGTGGGACGTGGAGCAAGATGG + Intergenic
979807891 4:124997348-124997370 TTGTGGAAAGGGTGGCAACCAGG - Intergenic
980508554 4:133756079-133756101 TGTTGGGAGGTGTGGGAAAAGGG - Intergenic
982364628 4:154562151-154562173 TTGTGGGAAATGAAGGAAAATGG + Intergenic
983574512 4:169246672-169246694 TTGTAGGAAGTGGGGAACAAAGG - Intronic
983924409 4:173383314-173383336 TTGTGGAAAGTGAGGCATTAAGG + Intergenic
984823803 4:183906572-183906594 TTGTGGGACGTGTGTAAAATCGG + Exonic
986344360 5:6820815-6820837 TTTTGGAAAGAATGGCAAAAAGG + Intergenic
988409713 5:30871486-30871508 TTGTGAGAAGTGTGGCTGAGTGG - Intergenic
988832239 5:34999174-34999196 TTCTGGGAGTTGTGGCAATAAGG - Intronic
989330854 5:40256776-40256798 TTGTGTAAAATGTGGAAAAATGG + Intergenic
989745033 5:44819296-44819318 TGGTGGGAACTGTGGCAAATCGG - Intronic
989954414 5:50340629-50340651 TTGGGGAATGTGTGGGAAAAAGG + Intergenic
990971366 5:61510205-61510227 GTGTGTGAGGTGGGGCAAAATGG + Intronic
992962326 5:81968530-81968552 TTGGGGGAAGGGAGGCAAAGAGG - Intergenic
995091222 5:108179926-108179948 TGGTGGGAAGAGTGGATAAATGG + Intronic
995301810 5:110593999-110594021 TTGTGGGGAGTCTGGCAAGATGG + Intronic
995390067 5:111630794-111630816 TTGGAGCAAGTGTAGCAAAATGG + Intergenic
996217606 5:120888334-120888356 TTGTGGGAAGTGCTGGAAAGTGG + Intergenic
996294008 5:121890338-121890360 TTGATGGAAGTCTGGCAAAGGGG - Intergenic
998504476 5:142660844-142660866 TTGTGGAAAGATTTGCAAAATGG - Intronic
999227543 5:150039037-150039059 TTGTGGGAAGGAATGCAAAATGG - Intronic
1000329696 5:160197024-160197046 TTTAGGGAAGGGTGGCAAATGGG - Intronic
1001415264 5:171541202-171541224 TTGTGAGAAGCGTGGCATAGAGG + Intergenic
1002551968 5:180001397-180001419 TTGTGGCACCTGTGGCAAAGTGG + Intronic
1004004662 6:11627879-11627901 TTGTTGGAAGTGTGAGAAGATGG + Intergenic
1005133650 6:22541766-22541788 TTGTGTGATGTGAGGCAAACTGG - Intergenic
1005987896 6:30885430-30885452 GGGTGGGAAGAGTGGCAATAAGG - Intronic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008453789 6:51684798-51684820 TTGAGAAAAGTTTGGCAAAAGGG + Intronic
1009585689 6:65598846-65598868 TTGTGGAAAATGAGGCAAAGAGG - Intronic
1009867933 6:69420126-69420148 ATGTGGGAAATGTGGCAAGAGGG + Intergenic
1011140233 6:84146444-84146466 TTGTGGGTAGTGGGGAAAATGGG - Intronic
1012547708 6:100438468-100438490 TTGGTGTAAGTGTGGTAAAAAGG + Intronic
1012712823 6:102629701-102629723 TCTTGGGAAGTGGAGCAAAATGG - Intergenic
1012976166 6:105783336-105783358 TTGGGGGAAATGTGACAAATTGG + Intergenic
1013016199 6:106162770-106162792 TTGTGGGAATTTTGTCAAATAGG - Intergenic
1013663264 6:112320539-112320561 TAGTGGGGAGTGGGGGAAAATGG + Intergenic
1015331206 6:131981475-131981497 AGGCAGGAAGTGTGGCAAAATGG + Intergenic
1015389629 6:132666699-132666721 CTGTGGGAAGTGTGAAATAAAGG - Intergenic
1015484451 6:133752467-133752489 TAGTGGGAGGTTTGGCAAAATGG + Intergenic
1019126724 6:169845681-169845703 TTGTAGGAACTGTGGCAAGCTGG + Intergenic
1021194758 7:17662946-17662968 GTGAGGGAAGGGTGGAAAAAAGG + Intergenic
1022799408 7:33761496-33761518 TTGGGGGAGGAGAGGCAAAAAGG - Intergenic
1025029793 7:55547818-55547840 TGATGGGAAGTGTGGTAAAATGG - Intronic
1025715028 7:63947591-63947613 TGTTGGGGAGTGGGGCAAAAGGG + Intergenic
1029973230 7:104809935-104809957 TTGTGGTAAGTGCTGCAATAAGG + Intronic
1030473581 7:109999349-109999371 TTGTGGGCATTGTGGCTATATGG - Intergenic
1030646292 7:112065295-112065317 TTGAAGGAAGTGTGGAAAAGAGG - Intronic
1030745156 7:113156248-113156270 TTGTGGGTAGTTGGGCAACATGG + Intergenic
1032144362 7:129365771-129365793 TTCTGGGGACTGTGGGAAAAGGG + Intronic
1033480942 7:141739718-141739740 ATGTGGTAAGTGAGGAAAAATGG - Intronic
1035651703 8:1270958-1270980 TTGTTAGACGTGTTGCAAAAAGG + Intergenic
1035717992 8:1768508-1768530 TTGATGCAACTGTGGCAAAATGG + Intronic
1036000387 8:4596025-4596047 CTGTGGGCAGTGTGGCAAACAGG - Intronic
1036457283 8:8920901-8920923 TTGTGGCATGTGTGGGGAAAAGG + Intergenic
1036668639 8:10765237-10765259 TTGGGGGAAATGTGGCGAGAGGG + Exonic
1038566819 8:28626472-28626494 TGGTGGAACGTGTGGCCAAATGG + Intronic
1040981166 8:53247541-53247563 TTGTGGTAAGAGTGGCAGAATGG + Intronic
1041112045 8:54492409-54492431 TTGTGAGCAGAGTGGCAGAAAGG - Intergenic
1041348398 8:56924710-56924732 TGGTGGAAAGTTAGGCAAAAGGG - Intergenic
1042051602 8:64715549-64715571 ATCTTGGAAGTGTAGCAAAATGG - Intronic
1043517380 8:81007198-81007220 TTGTGGGAAGTGCGGGAAAAAGG + Intronic
1045860542 8:106811244-106811266 TGGTGGGAACTGTGGAGAAATGG + Intergenic
1046365610 8:113227086-113227108 TTGTGGAAAGTGTGTACAAAAGG - Intronic
1047182084 8:122598482-122598504 TAGTGGGAGGTATGGCTAAAAGG + Intergenic
1047251662 8:123185635-123185657 TGGTGGGGACTGTGGCAAAGGGG - Intronic
1047636347 8:126767467-126767489 TTGTTGGAAGTGTGGCCTAGTGG + Intergenic
1049236839 8:141516503-141516525 GCGTGGGAAGTGTGGCAGCAGGG - Intronic
1050164731 9:2752845-2752867 TTCTGGGAAGTGTGGGAATTTGG + Intronic
1050719960 9:8577106-8577128 TGGTGGGGAGAGTGGAAAAAAGG - Intronic
1050994833 9:12203343-12203365 TTGTTGGAAGTGTGGCCTAGTGG - Intergenic
1051243058 9:15080552-15080574 CTGTGGGCAGTGAGGCATAAAGG - Intergenic
1051945111 9:22559671-22559693 TTGTTGGAGGTGGGGCATAATGG + Intergenic
1052152496 9:25134639-25134661 TGGTATGAAGTGTGGCAAACAGG + Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1055253502 9:74337304-74337326 TTGTAGTAAGTTTTGCAAAATGG - Intergenic
1057700397 9:97359898-97359920 CTGTGGGAAGTGCGGGAACAGGG - Intronic
1058546118 9:106061759-106061781 TGTTGGGAAGTGGGGCTAAATGG + Intergenic
1058586866 9:106516869-106516891 TTGAGGGAAGTGTAGAAAACTGG - Intergenic
1058601517 9:106675737-106675759 TTCTGGGAAGAGTTGCAACAAGG + Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059638494 9:116193216-116193238 TTGTTGGAAGTCTCACAAAAGGG + Intronic
1059936001 9:119311498-119311520 TTGTGGGGAGTGTAGCAAAGAGG - Intronic
1060696887 9:125717017-125717039 TTGTGGGAAGTGTGGCGCTTGGG - Intergenic
1060742488 9:126108691-126108713 TTGAGGGAATTGGGGCAAAGGGG - Intergenic
1061670748 9:132186871-132186893 CTGTTGGGAGTGTGGCACAAAGG + Intronic
1062246431 9:135569663-135569685 TTGTGGGGAGGGTGGTACAAGGG + Intergenic
1187203421 X:17157942-17157964 TGGTGGGGACTGTGGCAAATTGG + Intergenic
1187359417 X:18610872-18610894 TAGTGGGAAGTTAGGCAACATGG - Intronic
1191692679 X:63957175-63957197 ATGTGGGCTGGGTGGCAAAAGGG + Intergenic
1192016038 X:67332327-67332349 TTGTTGGTAGTATTGCAAAATGG - Intergenic
1195889567 X:109677382-109677404 TCATGGGTAGTGTGTCAAAAAGG + Intronic
1196038723 X:111176758-111176780 TTGTGGGGTGTGTGTGAAAATGG - Intronic
1196456542 X:115895332-115895354 TTGTGGCAAGCGTTTCAAAATGG - Intergenic
1197759051 X:130015058-130015080 TGGTGCCACGTGTGGCAAAAAGG + Exonic
1198254531 X:134913905-134913927 TAGTGGGAAGTTTGGAAAACAGG - Intronic
1198782016 X:140248023-140248045 TGGTGGGGCTTGTGGCAAAATGG + Intergenic
1199671167 X:150149454-150149476 ATGTGGTCAGTGTGGCAGAAAGG + Intergenic
1199876977 X:151940566-151940588 TTTGGGGAAGTCTGGGAAAAGGG - Intergenic
1200862333 Y:8006290-8006312 TTGTGGGCAGTGTGGTAGGACGG + Intergenic