ID: 969255572

View in Genome Browser
Species Human (GRCh38)
Location 4:5999523-5999545
Sequence CTGCTTCACAGTGGCAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969255572_969255579 16 Left 969255572 4:5999523-5999545 CCAGCATTGCCACTGTGAAGCAG No data
Right 969255579 4:5999562-5999584 CTTCCTTTTCCCGTGGGCAGTGG No data
969255572_969255577 9 Left 969255572 4:5999523-5999545 CCAGCATTGCCACTGTGAAGCAG No data
Right 969255577 4:5999555-5999577 CCAGAAGCTTCCTTTTCCCGTGG No data
969255572_969255578 10 Left 969255572 4:5999523-5999545 CCAGCATTGCCACTGTGAAGCAG No data
Right 969255578 4:5999556-5999578 CAGAAGCTTCCTTTTCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969255572 Original CRISPR CTGCTTCACAGTGGCAATGC TGG (reversed) Intergenic
No off target data available for this crispr