ID: 969259156

View in Genome Browser
Species Human (GRCh38)
Location 4:6022727-6022749
Sequence CCTCCGGGAGGCGGCGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969259156_969259170 9 Left 969259156 4:6022727-6022749 CCTCCTGCGCCGCCTCCCGGAGG No data
Right 969259170 4:6022759-6022781 AACGGGTCCTGGGCCCGGGCCGG No data
969259156_969259168 4 Left 969259156 4:6022727-6022749 CCTCCTGCGCCGCCTCCCGGAGG No data
Right 969259168 4:6022754-6022776 AAGAGAACGGGTCCTGGGCCCGG No data
969259156_969259162 -9 Left 969259156 4:6022727-6022749 CCTCCTGCGCCGCCTCCCGGAGG No data
Right 969259162 4:6022741-6022763 TCCCGGAGGGCAAAAGAGAACGG No data
969259156_969259166 -2 Left 969259156 4:6022727-6022749 CCTCCTGCGCCGCCTCCCGGAGG No data
Right 969259166 4:6022748-6022770 GGGCAAAAGAGAACGGGTCCTGG No data
969259156_969259164 -8 Left 969259156 4:6022727-6022749 CCTCCTGCGCCGCCTCCCGGAGG No data
Right 969259164 4:6022742-6022764 CCCGGAGGGCAAAAGAGAACGGG No data
969259156_969259172 17 Left 969259156 4:6022727-6022749 CCTCCTGCGCCGCCTCCCGGAGG No data
Right 969259172 4:6022767-6022789 CTGGGCCCGGGCCGGCCACATGG No data
969259156_969259176 29 Left 969259156 4:6022727-6022749 CCTCCTGCGCCGCCTCCCGGAGG No data
Right 969259176 4:6022779-6022801 CGGCCACATGGACTCCTCCGAGG No data
969259156_969259167 -1 Left 969259156 4:6022727-6022749 CCTCCTGCGCCGCCTCCCGGAGG No data
Right 969259167 4:6022749-6022771 GGCAAAAGAGAACGGGTCCTGGG No data
969259156_969259169 5 Left 969259156 4:6022727-6022749 CCTCCTGCGCCGCCTCCCGGAGG No data
Right 969259169 4:6022755-6022777 AGAGAACGGGTCCTGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969259156 Original CRISPR CCTCCGGGAGGCGGCGCAGG AGG (reversed) Intergenic