ID: 969263693

View in Genome Browser
Species Human (GRCh38)
Location 4:6050309-6050331
Sequence CTAAGGCTCTGAAAGTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969263688_969263693 26 Left 969263688 4:6050260-6050282 CCCAGCTTCACGGTGTGGGTATT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 969263693 4:6050309-6050331 CTAAGGCTCTGAAAGTTTACAGG 0: 1
1: 0
2: 0
3: 10
4: 149
969263687_969263693 27 Left 969263687 4:6050259-6050281 CCCCAGCTTCACGGTGTGGGTAT 0: 1
1: 0
2: 0
3: 7
4: 97
Right 969263693 4:6050309-6050331 CTAAGGCTCTGAAAGTTTACAGG 0: 1
1: 0
2: 0
3: 10
4: 149
969263689_969263693 25 Left 969263689 4:6050261-6050283 CCAGCTTCACGGTGTGGGTATTG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 969263693 4:6050309-6050331 CTAAGGCTCTGAAAGTTTACAGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969263693 Original CRISPR CTAAGGCTCTGAAAGTTTAC AGG Intronic
900534227 1:3169130-3169152 CTGAGGCTCAGAAAGTGTCCAGG - Intronic
902663251 1:17920123-17920145 CTGAGGATCTGAAAGTTGGCTGG + Intergenic
902925190 1:19691318-19691340 TTAAGGCCCTGGAAGTTTAGGGG + Intronic
903120189 1:21211194-21211216 CTTAGGCTCTGCTAGTTTAGAGG + Intergenic
904054437 1:27660754-27660776 ATGAGGCTCTGGAGGTTTACGGG + Intergenic
904541400 1:31236197-31236219 TTAAGGCTCTGAAGTTTGACAGG - Intronic
905269153 1:36775465-36775487 CTAAGGCACTGAAAGACAACTGG - Intergenic
906848459 1:49220783-49220805 CAGAGCCTCTGAAAGTTTAGGGG - Intronic
906880819 1:49587902-49587924 CTGAGGCTCTGTAATTTTTCAGG + Intronic
907594903 1:55710813-55710835 GTAAGGATCTGAAAGTCTATAGG - Intergenic
907648042 1:56263943-56263965 CCAAGGCTCAGAAAGTTATCAGG - Intergenic
907785106 1:57603752-57603774 CAAAGGCCCTGAAAATTCACAGG + Intronic
912196420 1:107402335-107402357 CTGAAGGTCTGAAAGTTTGCGGG + Intronic
912792870 1:112670229-112670251 CTAGGGCTTTCAAAGTTAACCGG + Exonic
914920028 1:151840096-151840118 CTCTGGCTCTGAAAGTTTCAGGG - Intronic
915014131 1:152717665-152717687 CTGAGGCCCTGAAAGTTTAAGGG - Intergenic
916904652 1:169269183-169269205 CTAAGGATCTGTAAGTTTTAGGG - Intronic
919430287 1:197483973-197483995 CTAGAACTCTGAAAGTTCACTGG - Intergenic
920525728 1:206664446-206664468 CCAAGTCTCTGAAAGGTGACTGG + Intronic
922212248 1:223495308-223495330 CTGAGGCACTGAAAGCTTAATGG + Intergenic
922228266 1:223664528-223664550 CTAAGGTTCACAGAGTTTACCGG + Intronic
924129485 1:240890739-240890761 CTGAGGCACAGAGAGTTTACAGG + Intronic
924171573 1:241347418-241347440 CTAAGTCTCTGAACTTTTAAAGG - Intronic
1066110747 10:32194603-32194625 CTCAGCCTCCCAAAGTTTACAGG - Intergenic
1066264958 10:33767571-33767593 CTTAGGTTAAGAAAGTTTACTGG - Intergenic
1071264430 10:83952042-83952064 CTGAGGCTCTGACAGGTTAAAGG + Intergenic
1072095731 10:92177585-92177607 CTAAATGTCTGAAGGTTTACTGG + Intronic
1073668960 10:105565658-105565680 CTGAGGCTTAGAAAGTTTAAGGG - Intergenic
1075429265 10:122366735-122366757 CAAAGGGTCTGAAAGCTTAGAGG + Intergenic
1075452658 10:122562878-122562900 CTGAGGCTCAGAAAGGTTATTGG + Intronic
1076103707 10:127803489-127803511 CTGTGGCTCTGAATGTTCACAGG + Intergenic
1078685587 11:13527918-13527940 TTGAGGCTCAGAAAGTTTAGAGG - Intergenic
1078769532 11:14335681-14335703 ATAAGACTCTGAAAGTTTGAGGG + Intronic
1078802042 11:14656152-14656174 CTTAGTGACTGAAAGTTTACTGG + Intronic
1079154293 11:17930131-17930153 CTAAGGCTCAGAGAGATTATGGG - Intronic
1080902382 11:36508870-36508892 CTAAGTGTCCAAAAGTTTACCGG + Intronic
1085681894 11:78583787-78583809 CTCAGGCTCAGTAACTTTACAGG + Intergenic
1085705876 11:78786525-78786547 CTGAGGCTCAGAAAGTTGACGGG + Intronic
1086258213 11:84905759-84905781 CTATGTCTCTTAAACTTTACAGG + Intronic
1088659245 11:112029142-112029164 CTGAGGCTGAGAAAGGTTACAGG - Intronic
1088900292 11:114110433-114110455 CAAAAGCCCTAAAAGTTTACTGG - Intronic
1089377683 11:118006058-118006080 CAAAGGTTCTGAAAACTTACTGG + Intergenic
1093274548 12:17108043-17108065 CTCAGGCTCTCACAGTCTACAGG - Intergenic
1095481624 12:42642144-42642166 CTGAGGCTCTGAAAGGTTTGGGG - Intergenic
1095685159 12:45024969-45024991 CCCATGCTCTGAGAGTTTACAGG + Intronic
1096060011 12:48689497-48689519 CAAAGTCACTGAAAGCTTACTGG + Exonic
1097083042 12:56447234-56447256 GCAAGGCTCTGAAAGTTCAAGGG - Intronic
1098874942 12:75857468-75857490 CTTGGGCTCTGAGAGTTTAAGGG + Intergenic
1102463270 12:113113334-113113356 CTGAGGCTCAGAGAGGTTACTGG + Intronic
1103686182 12:122733902-122733924 CTATTCCTCTGAAAGTCTACTGG + Intergenic
1111774027 13:92636588-92636610 ATAAGTCTCTGAAAATGTACTGG + Intronic
1113178364 13:107594955-107594977 CTATGGATCTGAAAGTGTACAGG - Intronic
1116735584 14:48686535-48686557 ATTAAGCTCTGAAAGTTTCCTGG + Intergenic
1118893305 14:69926429-69926451 CCCCAGCTCTGAAAGTTTACGGG - Intronic
1121761114 14:96445936-96445958 CTAGGGCTGTGAAAATTTAGTGG + Intronic
1127609178 15:60620698-60620720 CAAAGGCTCTGGAAGTTACCAGG + Intronic
1132416794 15:101626106-101626128 CTCAGCCTATGAAAGTGTACCGG + Intronic
1136360516 16:29776347-29776369 CTAAGGATCCGAAGGTCTACAGG - Intergenic
1138325852 16:56166869-56166891 CTAAGGCTCTGATACTACACGGG - Intergenic
1138521966 16:57576145-57576167 CCCAGGCTCTGAGACTTTACTGG + Exonic
1141283753 16:82652255-82652277 CCTGGGCTCTGAAAGATTACAGG + Intronic
1144375394 17:14634968-14634990 TTCAAGCTCTGAATGTTTACTGG + Intergenic
1144829776 17:18124661-18124683 CTGAGGCTCTGAAAATGTCCTGG - Intronic
1147776506 17:42905744-42905766 CTAAGGCTCAGAAAGTAGGCCGG + Intronic
1149442920 17:56690337-56690359 CTGAGGCTCTGAGAGGTTAAGGG - Intergenic
1158287642 18:55902305-55902327 CTGAGTCTCAGAAAGTTTAAGGG + Intergenic
925188551 2:1865454-1865476 CTAAGGCTCAGAAAGGTTCAGGG - Intronic
925729479 2:6907982-6908004 CTAAGGTGCTCAAAGTTTAGTGG + Intergenic
927226414 2:20769283-20769305 GTAAGGCTCAGAAAGTTTTGTGG - Intronic
927431421 2:23029459-23029481 CTGAGGCTCTGAAAGCTGACTGG - Intergenic
933935674 2:87201772-87201794 CTGAGTTTCTGGAAGTTTACAGG + Intergenic
934761655 2:96860033-96860055 CTAGGGCTGTGAATGTTTTCAGG - Exonic
936357475 2:111764053-111764075 CTGAGTTTCTGGAAGTTTACAGG - Intergenic
939877574 2:147595377-147595399 AAGAGGCTCTGAAAGTTGACAGG + Intergenic
939981565 2:148788683-148788705 CAAAGATTCTGAAAGCTTACTGG - Intergenic
944233842 2:197423642-197423664 CTAAGGTTCAGAAACTTCACTGG - Intronic
946467989 2:219929537-219929559 CTAACGCTCTGAGACTTTCCAGG - Intergenic
1171018156 20:21560490-21560512 CTAAGGCTTTGAACATTTCCCGG - Intergenic
1173564878 20:44031564-44031586 CTGAGGCTGTGACAGTTCACAGG + Intronic
1176305776 21:5122381-5122403 CAGAGGCTCAGACAGTTTACCGG + Intronic
1177689761 21:24490055-24490077 TTAATGCACTGAAATTTTACTGG - Intergenic
1179851281 21:44139650-44139672 CAGAGGCTCAGACAGTTTACCGG - Intronic
1184125408 22:42483221-42483243 TTGGGGCCCTGAAAGTTTACAGG + Intergenic
1184133892 22:42534719-42534741 TTGGGGCCCTGAAAGTTTACAGG + Intergenic
954853570 3:53624089-53624111 CCAAAGCTCTCAAAGTTAACAGG - Intronic
957172979 3:76763656-76763678 CTACGGCTTTGAAAGCTAACTGG + Intronic
960737745 3:120799120-120799142 CTAGGAATCTGAATGTTTACAGG + Intergenic
961269244 3:125676075-125676097 GTAATGCTCTGAATGTTGACAGG - Intergenic
964616886 3:158675746-158675768 GTAAGGGCCTGAAAGTTAACTGG - Intronic
966091320 3:176142175-176142197 TTAGGGCCTTGAAAGTTTACAGG + Intergenic
966366613 3:179194909-179194931 TTAAGGGTCTCATAGTTTACTGG - Intronic
967230432 3:187332677-187332699 CTAAGGCTCTGCACATTTGCTGG + Intergenic
967563013 3:190939518-190939540 CTAAGGTTCTGAAAGTAGATGGG - Intergenic
969263693 4:6050309-6050331 CTAAGGCTCTGAAAGTTTACAGG + Intronic
969429921 4:7148125-7148147 CTGAGGCTCAGAAGGTTTAAGGG + Intergenic
970200979 4:13604986-13605008 CAAAGACTCTGAAAGTCTCCGGG + Exonic
971241183 4:24890338-24890360 CTAAGGCTCTAAGAGTTTTTTGG + Intronic
974961993 4:68714069-68714091 TTTAGGATCTGAAAGTATACCGG - Intergenic
976347722 4:84024678-84024700 CTGAGCCCCTGAAAGTTTACTGG + Intergenic
977767666 4:100819362-100819384 CTAATACTCTGAATGTTTACAGG - Intronic
978277528 4:106969620-106969642 CAAAAGCTTTCAAAGTTTACAGG - Intronic
979472303 4:121113777-121113799 CTAAGGTTCTGAAGGTCTAAGGG + Intergenic
980776828 4:137447669-137447691 CTAAGGCTCTGCAATTTTTGTGG - Intergenic
980947297 4:139334676-139334698 GTAATGTTCTGAAAGTTTATAGG + Intronic
981126125 4:141108893-141108915 CTCAGGCTCTGAAATTTCACTGG + Intronic
982422394 4:155212439-155212461 CTAAGGCTCTCACATTTTACTGG - Intronic
984202771 4:176746415-176746437 CCAAGGCTCTGGAAGGTTGCTGG - Intronic
984865370 4:184276041-184276063 CTAATGCTTTAAAAGTTTTCAGG + Intergenic
987590016 5:19912326-19912348 CTGAGGCTCTGGGAGTTTAAGGG + Intronic
987714358 5:21547623-21547645 CTAAAGCTGAGAAAGTTCACAGG - Intergenic
990192584 5:53276631-53276653 CTAATGCCCTGAATGTTTAGTGG + Intergenic
991011071 5:61883616-61883638 CTATGGCTTTGAGAGTTTTCTGG - Intergenic
991322847 5:65394807-65394829 CTAAGACTCTGTAAGTTTGGAGG - Intronic
992667838 5:79028387-79028409 CTAAGTCTCTGAAATTTAAAAGG - Intronic
994385745 5:99129548-99129570 ATAAGGCTGTGAAAGTATAATGG - Intergenic
995726153 5:115182199-115182221 CTGAAGCTCTGAAAGTTGAATGG - Intergenic
995922706 5:117332630-117332652 CTAAGGGTCAGAACGGTTACTGG + Intergenic
997649739 5:135507485-135507507 CTGAGGCTCAGAAAGTTCATGGG - Intergenic
998808392 5:145940838-145940860 CTAAGGCTCTCAAAGTGTTTTGG - Intronic
999143896 5:149380185-149380207 CTGAGGCTCAGAAAGATTTCAGG - Intronic
1000128057 5:158266749-158266771 CAAAGGCTCTGAAATATGACTGG - Intergenic
1000308580 5:160019233-160019255 ATTAGGCTCTGAAAGTTTTAAGG + Intronic
1000531963 5:162434028-162434050 CTGATGATCTGAAAGTTTAAAGG + Intergenic
1005494156 6:26374364-26374386 CTGATGCTCTGTAAGTTTGCTGG + Exonic
1007585483 6:42986478-42986500 CTCAGGCCCTGAAAGGTTAAGGG - Intronic
1007783545 6:44267575-44267597 CTCAGCCTCTCAAAGTTTATAGG - Intergenic
1009002367 6:57734455-57734477 CTAAAGCTGAGAAAGTTCACAGG + Intergenic
1009761300 6:68010242-68010264 CTAAGGACCTGGAAGTGTACTGG + Intergenic
1010573526 6:77506462-77506484 CTCAGGCTGGGAAAGTTGACTGG - Intergenic
1011108447 6:83809655-83809677 CACGGGCTCTGAAATTTTACAGG + Intergenic
1013328318 6:109070406-109070428 CTTAGGCTCAGAAAGTGGACAGG + Intronic
1014572904 6:123032829-123032851 CTGAGGCACAGAAAGTTTAAAGG - Intronic
1015622205 6:135142817-135142839 CTAAACCTCTGCCAGTTTACTGG - Intergenic
1020770202 7:12381339-12381361 CTGGGGATCTGAAAGTTTTCTGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1028707360 7:93865242-93865264 CCAAGGCTCTAATATTTTACTGG + Intronic
1030603416 7:111613950-111613972 CTGAGACTCTGAAGGTTAACAGG + Intergenic
1033616977 7:143026000-143026022 CTAAGGCTATGAGAGTCTCCTGG + Intergenic
1034501050 7:151451381-151451403 CTGAGGCTCTGGAAGGTTCCTGG + Intergenic
1036681686 8:10878805-10878827 TTAAGGCTCAGAAAGTCTACAGG - Intergenic
1038038676 8:23706465-23706487 CTCAGGTACTGAAAGTTTTCCGG + Exonic
1038201693 8:25418889-25418911 CAAACCCTTTGAAAGTTTACTGG - Intergenic
1039341151 8:36651682-36651704 CAAAGGCCGTGAAAGTGTACTGG + Intergenic
1042078954 8:65028378-65028400 GAAAGGCTCTGAAATATTACTGG + Intergenic
1043402940 8:79901728-79901750 CTAAGACTCTGAAAGTCTGGAGG - Intergenic
1045128123 8:99117081-99117103 CTGAGACTCAGAAAGTTTTCAGG + Intronic
1045791608 8:105990379-105990401 CTAAGGTTCAGAAAATTTTCTGG - Intergenic
1046768598 8:118097003-118097025 CTGAGGCTCTGAAGGTATAATGG + Intronic
1047391835 8:124458759-124458781 CTCAGCCTCCCAAAGTTTACAGG - Intronic
1051566305 9:18502872-18502894 TATGGGCTCTGAAAGTTTACAGG - Intronic
1054882251 9:70156294-70156316 CTAGGGTTCTGAAATTTTAAAGG + Intronic
1055326299 9:75133638-75133660 CTCAGGCTTAGAAAGGTTACTGG + Intronic
1056738041 9:89226326-89226348 ATTAGGCTCTGAAAGGCTACAGG - Intergenic
1057534456 9:95885885-95885907 CAAAGGCTCTGAAACTTTAGTGG - Intronic
1058047379 9:100370987-100371009 CTAAGACTCTGAAAATTAGCTGG + Intergenic
1059934487 9:119295293-119295315 CTCAGACTCTGAAAGTGGACAGG + Intronic
1186669169 X:11752480-11752502 CTAAGGCTCAGAAATGTTAAGGG - Intergenic
1188996815 X:36896872-36896894 CTAAGGCTCAGAAAGTGCTCAGG - Intergenic
1194493043 X:94575393-94575415 ATAAGACTCTGAAAGTTTCAAGG - Intergenic
1194764974 X:97839125-97839147 TTGAGACTCTGAAAATTTACTGG + Intergenic