ID: 969266098

View in Genome Browser
Species Human (GRCh38)
Location 4:6065074-6065096
Sequence TCGTGGGCATGCCAGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969266090_969266098 -2 Left 969266090 4:6065053-6065075 CCAGAGTCTACCAGTCCCTGGTC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 969266098 4:6065074-6065096 TCGTGGGCATGCCAGTGCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969266098 Original CRISPR TCGTGGGCATGCCAGTGCAG GGG Intronic
900075372 1:811731-811753 TCCTGGGCCTGCCTGGGCAGTGG + Intergenic
901418976 1:9137394-9137416 TGGTGGCCATTCCACTGCAGCGG + Intergenic
901789540 1:11647131-11647153 TCCTGGGCCCTCCAGTGCAGTGG - Intergenic
903070394 1:20724317-20724339 TGGGGGGCATGTCAGGGCAGGGG - Intronic
903361378 1:22779364-22779386 TCATGGGGATGCCAGTGCACAGG + Intronic
906476170 1:46171132-46171154 CTCTGGGCATGCCGGTGCAGAGG + Intronic
908176971 1:61565628-61565650 TCCTGGGCACACCAGTGCAAGGG + Intergenic
911564090 1:99441929-99441951 AAGTGGGCAGGCCAGTTCAGAGG + Intergenic
912567949 1:110602060-110602082 TCGCGGGCATGACTGTACAGTGG - Exonic
917641525 1:176987590-176987612 TAGTGGGCATGACAGGGCAATGG - Intronic
918047737 1:180951694-180951716 TGGTGGGCATGCCAGAGGAAAGG + Intergenic
922267452 1:223997218-223997240 TAGTGAGCATCCCAGTGCACAGG + Intergenic
923080034 1:230644653-230644675 ATGAGGGCATGCTAGTGCAGTGG + Intronic
1065125472 10:22569417-22569439 TGCTGGGCATGGCTGTGCAGAGG - Intronic
1074560304 10:114529683-114529705 TCGTGTGCATGCATGTGCACAGG - Intronic
1076980901 11:204236-204258 TCGTTGCCCTGCCAGTCCAGTGG + Exonic
1078403104 11:11045088-11045110 TCCTGGCCAAGCCAGTGAAGAGG - Intergenic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1101516301 12:105438751-105438773 TCCAGGGCATGCCAGTGCAAGGG + Intergenic
1102624328 12:114222436-114222458 TTCTTGGCATTCCAGTGCAGAGG + Intergenic
1104986449 12:132600256-132600278 AGGTGGGCATGGCAGGGCAGGGG + Intergenic
1105794291 13:23834736-23834758 TCGTGGCCCTGCCTGTGCACAGG + Intronic
1105810400 13:23990349-23990371 GCCAGGGCATGCCAGTCCAGAGG - Intronic
1110485047 13:76029401-76029423 TCTTGGACATACCACTGCAGTGG + Intergenic
1112951061 13:104997561-104997583 TGTAGGGCATGCCATTGCAGAGG + Intergenic
1113064976 13:106363768-106363790 TCGTGTGTATGACAGTCCAGAGG - Intergenic
1113586846 13:111471609-111471631 TCGGGACCATGCAAGTGCAGCGG + Intergenic
1119444146 14:74649439-74649461 TGGAGGGCAGGCCAGTGCCGGGG + Intergenic
1124934383 15:34156424-34156446 TCGTGCGCATGGCAGGCCAGAGG - Intronic
1128683481 15:69667652-69667674 TGGTGAGCATCCCAGTGCTGAGG - Intergenic
1128736486 15:70056658-70056680 TAGTGGGCCTGCCAGTGGAGAGG + Intronic
1129552819 15:76472086-76472108 TCTTGGGCATGGCAGTGATGCGG - Intronic
1131198744 15:90378794-90378816 TGCTGGGCATACCGGTGCAGTGG + Intergenic
1133088894 16:3388236-3388258 AGGTGGGCATGCCAGTTCACTGG - Intronic
1136578684 16:31139342-31139364 TCGTGGGCATGGCTGTTCAAGGG - Exonic
1142127083 16:88415515-88415537 GCCTGGGAATGGCAGTGCAGTGG + Intergenic
1143977919 17:10844076-10844098 TCTTGCCAATGCCAGTGCAGAGG + Intergenic
1152251596 17:79215406-79215428 TCCTTGGCATGGCAGAGCAGGGG - Intronic
1158023602 18:52870400-52870422 TGGTGGGCAATCCAGAGCAGCGG - Intronic
1162361541 19:10223582-10223604 TCCTGGGGAGGCCAGGGCAGGGG - Intronic
1162782425 19:13013204-13013226 TCCTGGGCAGGCCAGGGGAGAGG + Intronic
1163022896 19:14493046-14493068 TCCTGGGCAGGGCAGGGCAGAGG - Intronic
1165171468 19:33894895-33894917 GCGTGTGCATGGCATTGCAGTGG - Intergenic
925427878 2:3765856-3765878 TCTTGGGAATGACAGGGCAGAGG + Intronic
927519441 2:23690121-23690143 TCCTGGCCATGCCTGTGCTGAGG + Intronic
932816312 2:74865017-74865039 ACGTGCCCATGCCAGAGCAGTGG - Intronic
933834424 2:86233815-86233837 TCGGGTGCATGGCACTGCAGTGG + Intronic
935756923 2:106283604-106283626 TTGGGTGCATGCCAGGGCAGAGG + Intergenic
937279219 2:120705855-120705877 CCGTGGGCCTGGCAGTGCGGTGG + Intergenic
938374260 2:130795517-130795539 CCGTGGGGCTCCCAGTGCAGTGG - Intergenic
938766062 2:134461099-134461121 TCGTGGGGCTGGCACTGCAGAGG - Intronic
942629264 2:177938360-177938382 TGGTAGGCATGGCAGAGCAGAGG - Intronic
943349358 2:186779262-186779284 TTTTGGGCAAGCCAGGGCAGGGG - Intergenic
946517759 2:220431607-220431629 TCCTGGACATCCCAGAGCAGAGG + Intergenic
947105260 2:226662222-226662244 TCGTGGGCAGCCATGTGCAGTGG - Intergenic
948336078 2:237208192-237208214 TCCTGGGAATGTCAGTGCAGTGG - Intergenic
948861502 2:240754862-240754884 GCGTGGCCTTGCCAGTCCAGAGG + Intronic
949082351 2:242113064-242113086 TCCTGGGCCTGCCTGGGCAGTGG - Intergenic
1169119150 20:3084873-3084895 ACGTGGGCCTGTCTGTGCAGGGG + Intergenic
1169254131 20:4084338-4084360 TGGTGGCCTGGCCAGTGCAGTGG + Intergenic
1172878704 20:38182801-38182823 TCCTGGGCAGGCCAGTTTAGCGG + Intergenic
1175546247 20:59779828-59779850 TCGTGGGTATGCCTGGTCAGCGG + Intronic
1181556621 22:23675089-23675111 GCTTGGGCCTGCCAGTGCTGTGG - Intergenic
1184815472 22:46865657-46865679 CTGTGGACATGCCTGTGCAGGGG - Intronic
1185294282 22:50045704-50045726 TCATGGTCATGGCAGTACAGAGG - Intronic
949887050 3:8703955-8703977 TGGTGGGCATGTGAGTGCTGAGG - Intronic
951620276 3:24593901-24593923 GCTTGGGCATGGCACTGCAGGGG - Intergenic
954907747 3:54077225-54077247 TTCTGGGCTTGCCTGTGCAGTGG - Intergenic
956123331 3:65987951-65987973 GCAGGGGCATGCAAGTGCAGGGG - Intronic
958732288 3:97972343-97972365 TCGTGGGCATCCCAGCGCCGGGG - Exonic
958833172 3:99114288-99114310 TAGTGAACATGCCAGTGCAGAGG - Intergenic
959902710 3:111677718-111677740 TCTTGGGAATGGCAGAGCAGTGG + Intronic
960545254 3:118906645-118906667 TCTTGGCAATACCAGTGCAGTGG - Intronic
961666622 3:128496899-128496921 ACGTGGGTGTGCCAGTGCATGGG + Intergenic
963005953 3:140726400-140726422 TCCTGGGTCTGCCAGAGCAGAGG + Intergenic
967825438 3:193873697-193873719 TCTGGGGCAGGGCAGTGCAGTGG + Intergenic
969266098 4:6065074-6065096 TCGTGGGCATGCCAGTGCAGGGG + Intronic
970912960 4:21299589-21299611 GCGTTGGCATGCCATTGCACTGG + Intronic
978689023 4:111484148-111484170 CCTTGGGCACCCCAGTGCAGTGG + Intergenic
981660331 4:147158577-147158599 TCGTGGACATTCCAGGGAAGGGG - Intergenic
982070438 4:151689510-151689532 TCGTGGGGCTGACAGTTCAGAGG - Intronic
982319916 4:154067277-154067299 TCGTGGGCATGCCTCTGAACTGG - Intergenic
984598291 4:181696903-181696925 TCCTGGGCATGCCAGTGAACAGG + Intergenic
988386781 5:30575304-30575326 TCCTGGGCATACCAGGACAGGGG - Intergenic
989086744 5:37684878-37684900 TGCTGGGAATGCCTGTGCAGAGG - Intronic
992399175 5:76395921-76395943 TCGTGATCATGCCAGGGCAACGG + Intergenic
993508391 5:88740074-88740096 TCTTGGCCATACCAGTTCAGGGG + Intronic
995236636 5:109836401-109836423 TGGAGGGCATGCCGGTGCGGTGG - Intronic
997833638 5:137174705-137174727 TCTTGGGCCTGCCAGTGAACTGG - Intronic
999716604 5:154365975-154365997 TCCTGGACAAGTCAGTGCAGTGG - Intronic
999910072 5:156188039-156188061 TCGGGGTCATGCTAGTGCAGGGG + Intronic
1000127900 5:158265225-158265247 TTGTGGGCTTTCCAGTGCATGGG + Intergenic
1005516148 6:26556251-26556273 TTTTGGGAGTGCCAGTGCAGGGG + Intergenic
1006408072 6:33856658-33856680 CCGAGGGCTTGCCAGAGCAGAGG - Intergenic
1006417480 6:33913246-33913268 TCGAGGGCCAGACAGTGCAGAGG + Intergenic
1009266090 6:61556281-61556303 TGGTGGCAATGGCAGTGCAGGGG + Intergenic
1011626779 6:89289599-89289621 TGGGGGGCACGCCAGAGCAGGGG + Intronic
1015881669 6:137876064-137876086 TCCTGGGCAGGCCAGTGGAGAGG - Exonic
1017654367 6:156613636-156613658 TCCAGGGCACACCAGTGCAGTGG + Intergenic
1021939151 7:25662649-25662671 TTGTGAGCATGCCAGTACACAGG - Intergenic
1032490849 7:132323116-132323138 TCGTGGGGATCACAGTTCAGTGG - Intronic
1035540271 8:429790-429812 TCCTGGGCCTGCCTGGGCAGTGG - Intronic
1035730880 8:1852990-1853012 TCCTGGGCAGGCCAGAGGAGAGG + Intronic
1038930427 8:32187910-32187932 TCCTTGGTATGCCAGTGCAGAGG + Intronic
1040085503 8:43336034-43336056 TGGTGGGCAAGCAAGGGCAGCGG + Intergenic
1041780028 8:61568023-61568045 TCGAGGACAGGCCAGTGCAGTGG + Intronic
1044561331 8:93615296-93615318 TCGTGTGCATGCCTGTACACAGG - Intergenic
1044952856 8:97450752-97450774 GCATGGGCATGCCAGGGCGGAGG + Intergenic
1046876409 8:119259528-119259550 TTGTGGACATGCCAGGGAAGGGG + Intergenic
1049368625 8:142252998-142253020 ACGTGGGCAGGGCAGGGCAGAGG - Intronic
1050290413 9:4148562-4148584 TCATGGGCCTGCCAGTTTAGGGG - Intronic
1060966542 9:127715129-127715151 GCGTGGGCATGGCGGTGCTGGGG - Exonic
1061672110 9:132194539-132194561 TGGTGGGCTTGCCAGTGGTGTGG + Intronic
1185783248 X:2867266-2867288 GCGTGGGCATGACAGTGGGGTGG - Intronic
1192633968 X:72801253-72801275 CAGTGGGCATGCCAATGCTGAGG - Intronic
1192647742 X:72919548-72919570 CAGTGGGCATGCCAATGCTGAGG + Intronic
1195447436 X:104970643-104970665 TGGTGGGCATGTCTTTGCAGAGG + Intronic
1200065621 X:153502961-153502983 TAGGGGGGATGCCAATGCAGGGG + Intronic
1200090353 X:153633062-153633084 TCTGGGGCACGCCAGTGCACGGG + Intergenic