ID: 969266321

View in Genome Browser
Species Human (GRCh38)
Location 4:6066444-6066466
Sequence ATGCATATTAAAAAGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969266321 Original CRISPR ATGCATATTAAAAAGCAAGG AGG (reversed) Intronic
900960245 1:5914540-5914562 ATGCATATTGAAAAGTTATGTGG - Intronic
903108468 1:21106594-21106616 ATGCCTATGAAAAATCCAGGAGG + Intronic
904351600 1:29910797-29910819 ATGCACATTAAAAAGTAAAAAGG + Intergenic
904433977 1:30482306-30482328 CTACAAATTAGAAAGCAAGGAGG - Intergenic
904980310 1:34495460-34495482 AGGCAGATTATAAAGCAAGCAGG + Intergenic
905082316 1:35335012-35335034 ATACATTTTAAAAAGCTAAGTGG - Intronic
907415579 1:54311778-54311800 ATCACTATAAAAAAGCAAGGAGG + Intronic
907737267 1:57126687-57126709 ATGCATATTGAACTGCAATGAGG - Intronic
907872346 1:58454608-58454630 ATGCTACTTAGAAAGCAAGGAGG - Intronic
909514673 1:76493772-76493794 ATGCATATTAAAAAAAGAAGAGG + Intronic
910026983 1:82667134-82667156 ATGAATAGTAAAAAGCTCGGAGG + Intergenic
910766606 1:90788714-90788736 TTGGATATTAAAAAATAAGGAGG - Intergenic
910824665 1:91393017-91393039 ATGCATTATAAAAACCAACGTGG + Intronic
911635851 1:100235282-100235304 ATGCATTTTTAAAAGCAATAAGG - Intronic
911731934 1:101300595-101300617 AAGCTTATTGAAAGGCAAGGAGG - Intergenic
912533506 1:110343941-110343963 ATGCATAGTGAAAACCAAGAGGG - Intronic
913389764 1:118297626-118297648 GTTTATATTAAAAATCAAGGGGG - Intergenic
913414716 1:118592252-118592274 ATTCATCTTAAAAAGGAATGAGG + Intergenic
913415370 1:118599659-118599681 ATGCAGTTTAAAAAGCAATTGGG - Intergenic
913536635 1:119779190-119779212 TTGCAAATTAAAAAAAAAGGGGG - Intergenic
915548675 1:156618999-156619021 ATGGAGATTAGACAGCAAGGAGG - Intergenic
915762740 1:158331299-158331321 TTGGATTTTAAAAAGCAAGCAGG - Intronic
916098158 1:161369832-161369854 AAGCAAATCAAAAAGCAATGTGG - Exonic
916255140 1:162779558-162779580 ATGCATATTAAAAATAAGAGAGG + Intronic
916843073 1:168620301-168620323 ATGCTTATTAAAAATCCAAGTGG + Intergenic
916979934 1:170124306-170124328 ATGTATATTTAAAAGCATGCTGG + Intergenic
917349694 1:174064114-174064136 ATCCATTTTAAAAGGCAAAGAGG - Intergenic
917918257 1:179726366-179726388 CAGCTTATTCAAAAGCAAGGGGG - Intergenic
918791260 1:188833451-188833473 ATGAATATTAAAAATCAACGAGG - Intergenic
920245455 1:204584515-204584537 AAGCATATTAAAAAGCAATGTGG + Intergenic
920713412 1:208316877-208316899 ATGCTTGTGAGAAAGCAAGGGGG + Intergenic
921504307 1:215948656-215948678 ATGTATAATAAAAATCAAGAGGG - Intronic
922609673 1:226916245-226916267 ATGCCTTGTAAAAAGCAAGATGG + Intronic
922687638 1:227657256-227657278 ATGCATAATAAAAGGCAAAGGGG - Exonic
923261991 1:232276337-232276359 ATGCAGATTAAACAGCCAGGAGG - Intergenic
924049216 1:240063413-240063435 ACTCATTTTAAGAAGCAAGGAGG - Intronic
1063283924 10:4662259-4662281 AAGAAGATTAAAAAGGAAGGGGG - Intergenic
1063806690 10:9652967-9652989 ATGCATATTAAAATGAAAGATGG + Intergenic
1065183162 10:23146766-23146788 CTGCATACTTAAAAGCAAGAAGG - Intergenic
1065906448 10:30257229-30257251 ATGCTTAGGAAAAAACAAGGGGG - Intergenic
1068157980 10:53225114-53225136 AAGAATATTAAAAAGGAATGAGG + Intergenic
1068182858 10:53545190-53545212 ATGCATATTAAAAGACAAAATGG - Intergenic
1070205141 10:74251268-74251290 ATGCCTATTCAAGAGAAAGGAGG + Intronic
1070897826 10:80000205-80000227 ATGTTTAAGAAAAAGCAAGGAGG - Intergenic
1070991129 10:80733044-80733066 ATGTACATTAAGAGGCAAGGTGG + Intergenic
1071923032 10:90372971-90372993 ATGGAGATTTAAAAGCAGGGAGG + Intergenic
1072688292 10:97552076-97552098 ATATATATTAAAAAGACAGGAGG - Intronic
1072909149 10:99484575-99484597 ATGAATGTTAAACAGGAAGGGGG - Intergenic
1073612082 10:104954387-104954409 AAGGGTATTAAAAAGCCAGGTGG + Intronic
1073874657 10:107908271-107908293 AAGCATTTTAAAAAGCAAAAAGG + Intergenic
1073946246 10:108754039-108754061 ATTCATTTAAAAAGGCAAGGGGG - Intergenic
1073980828 10:109151747-109151769 ATTCAAAATAAAAAGCAAGAAGG - Intergenic
1074005431 10:109418122-109418144 TTGCATTTTAAAGAGCAAGGCGG - Intergenic
1074242464 10:111652695-111652717 ATGGAGATTAAAATTCAAGGTGG + Intergenic
1074522990 10:114241514-114241536 ATGCTCATTAAAAAGCCAGGAGG - Intronic
1076262028 10:129074534-129074556 ATGGCCATTAAAGAGCAAGGCGG - Intergenic
1077729718 11:4717037-4717059 AAGCATATTCAAAGGCAATGGGG - Intronic
1077981073 11:7301387-7301409 AGTCATATTAAAAAGCAGGTGGG + Intronic
1078821475 11:14887295-14887317 AGGGATCATAAAAAGCAAGGAGG + Intronic
1078877586 11:15413601-15413623 ATTCATATAAAAATGCATGGGGG + Intergenic
1080109804 11:28553764-28553786 TTGCAGATTAAAAGGCTAGGAGG - Intergenic
1081548979 11:44095112-44095134 ATGCATATGCAAAAACAAGAGGG - Intergenic
1081954035 11:47073663-47073685 ATGCTTTTTGAAAAGAAAGGAGG + Intronic
1083458082 11:62792183-62792205 CTTTATATTAAAAAGTAAGGAGG + Exonic
1083831387 11:65236169-65236191 ATGCAAATAAAGGAGCAAGGAGG + Intergenic
1084062395 11:66684970-66684992 ATTCATGTTAAAAAGCAATGAGG - Intergenic
1084925285 11:72506569-72506591 ATGCATATTTAAAACCCAGCAGG + Intergenic
1087375174 11:97330649-97330671 ATACATATCAAAAAGCAAAAAGG - Intergenic
1087549542 11:99630890-99630912 ATGCACATTGAAAAGCACCGTGG + Intronic
1087687378 11:101280446-101280468 ATACATATTAAAAAAAAAGTTGG - Intergenic
1087900030 11:103630165-103630187 ATGAATTTTAAAAAGCATGAAGG - Intergenic
1089364437 11:117912498-117912520 ATGCATTTTCACAAGCACGGCGG + Intronic
1091008000 11:131971136-131971158 ATCCATATTGAAAAGCAATATGG - Intronic
1091111096 11:132968840-132968862 AAGCATATTAATAGGGAAGGAGG - Intronic
1091543994 12:1488283-1488305 ATACAGATTAAAAAGCAAAAAGG - Intronic
1091730756 12:2878308-2878330 ATGCCTTTTACAAAGAAAGGAGG + Intronic
1093053376 12:14530786-14530808 ATGCAAATTAATAATCAAGGAGG - Intronic
1093528478 12:20133351-20133373 AGGCATATTAAAAAGCAGTAAGG - Intergenic
1094478129 12:30858027-30858049 ATGCACATCAAAAAGCATGCAGG + Intergenic
1095274901 12:40269685-40269707 ATAAATATTAAAAAACAATGAGG + Intronic
1096267166 12:50132993-50133015 AGGCATAGAAAAAAGGAAGGAGG + Intronic
1096293541 12:50362923-50362945 ATGCTTTAAAAAAAGCAAGGAGG + Intronic
1096751747 12:53763791-53763813 TTGCATATTGGAAAGTAAGGTGG + Intergenic
1097146631 12:56944192-56944214 ATCCAAATTAAAAAGGAAGAAGG - Intergenic
1097235933 12:57539614-57539636 ATGCATATGAAAAACCATGGTGG + Intronic
1097754012 12:63389131-63389153 ATGCAAATTACAAAGCACAGTGG - Intergenic
1099847443 12:88046043-88046065 CTGAATTTTTAAAAGCAAGGGGG - Intronic
1099981942 12:89614415-89614437 ATGCTTATAAAATAGCCAGGTGG - Intronic
1101181547 12:102224047-102224069 ATGCATTTTATAAGACAAGGTGG - Intergenic
1102650042 12:114434946-114434968 GGTCATATTAAAAAGCAGGGTGG - Intergenic
1105648316 13:22345705-22345727 ATGCATAGTAAATAGCAAGAAGG + Intergenic
1107197349 13:37668443-37668465 AGACATATTAAAAAACAAAGTGG + Intronic
1107813529 13:44222556-44222578 ATGCATATCAAAAGACACGGAGG - Intergenic
1108702194 13:52953197-52953219 ATGCACATTAAGAAGCGAAGTGG - Intergenic
1109844607 13:67970693-67970715 AGGCATATTCAAAAGCAAAGAGG - Intergenic
1110126333 13:71947538-71947560 ATGGAAATTAAAGAGCATGGAGG + Intergenic
1110932825 13:81244294-81244316 CAGCATATAAAAAAGGAAGGGGG - Intergenic
1111064060 13:83067171-83067193 ATGTATATCAAAAATCAAAGTGG + Intergenic
1111520647 13:89398793-89398815 ATAGATACTAAATAGCAAGGTGG - Intergenic
1111737516 13:92160775-92160797 ATGAATAATAAAAAGCAAATGGG + Intronic
1111955824 13:94757555-94757577 ATGAATTTCAAAAAGCAATGGGG - Intergenic
1112626392 13:101109287-101109309 ATGGATATTAAAAATCATGGTGG + Intronic
1113207409 13:107933105-107933127 CTGCATATTACAGAGAAAGGAGG + Intergenic
1115446211 14:33493172-33493194 TGGCAAATTAAAATGCAAGGTGG + Intronic
1116117480 14:40674298-40674320 TTACATCTTATAAAGCAAGGAGG + Intergenic
1116494146 14:45540104-45540126 AAGAAAATTAAAAAGAAAGGAGG - Intergenic
1116758001 14:48972457-48972479 AGGCAGATTAAAAAAAAAGGTGG - Intergenic
1117152116 14:52900369-52900391 ATACATATAAAAAAGCATGAGGG + Intronic
1117791384 14:59345531-59345553 ATTCAGTTTAAATAGCAAGGTGG + Intronic
1118207891 14:63740267-63740289 ATACATATTTAAAAGTGAGGTGG - Intergenic
1118487912 14:66231586-66231608 ATTCATAGTTAAAAGTAAGGTGG + Intergenic
1118488024 14:66232576-66232598 ATTCATATTTAAAAATAAGGTGG + Intergenic
1119503521 14:75151599-75151621 ATGCATATGTAAGAGGAAGGGGG - Intronic
1120097668 14:80406996-80407018 ATCCACATTGAAAAGGAAGGAGG + Intergenic
1122217912 14:100215896-100215918 ATGTATATTAAAACTCACGGAGG - Intergenic
1123497099 15:20838250-20838272 ATGCATATTAAGAAGAAAACTGG + Intronic
1123590578 15:21849205-21849227 ATGCATATTAAGAAGAAAACTGG + Intergenic
1124443284 15:29705663-29705685 AGGCATATTTAACAGCAATGGGG - Exonic
1124865318 15:33484987-33485009 ATGTTTATTAAAAAGAGAGGAGG + Intronic
1125252558 15:37722426-37722448 AGGGATATGAAAAAGCAGGGAGG - Intergenic
1126298100 15:47164478-47164500 GGGCATATTAAAAGGCAAAGTGG - Intergenic
1127418339 15:58779605-58779627 ATCTATATTTAAAAACAAGGTGG - Intronic
1130933382 15:88448849-88448871 ATGTCTTTTAAAACGCAAGGTGG + Intergenic
1131786967 15:95923816-95923838 AAGCATATCAGAAAGCAAGTCGG + Intergenic
1132139122 15:99375814-99375836 ATTAATATTAAAAATGAAGGAGG - Intronic
1132225619 15:100138914-100138936 ATACATTTTAAAAAACAAGAAGG + Intronic
1202962680 15_KI270727v1_random:139082-139104 ATGCATATTAAGAAGAAAACTGG + Intergenic
1133380994 16:5330359-5330381 AGTCATCTTAAAAAGCAAGAGGG - Intergenic
1134659220 16:15971252-15971274 TTGCATATTAAAAGGCTAGGTGG - Intronic
1135504278 16:23022543-23022565 AGGCATAATAGCAAGCAAGGTGG + Intergenic
1136274225 16:29168941-29168963 AAGCACATTTAAAAGCCAGGCGG + Intergenic
1137633891 16:49968722-49968744 ATGCATATTTAACAGCATTGAGG - Intergenic
1137690280 16:50421692-50421714 AAGCATATACAAAAGTAAGGAGG + Intergenic
1138384127 16:56624990-56625012 CTTTAAATTAAAAAGCAAGGTGG - Intergenic
1138895186 16:61195930-61195952 ATTAATATATAAAAGCAAGGTGG + Intergenic
1142078506 16:88134588-88134610 AAGCACATTTAAAAGCCAGGCGG + Intergenic
1144342365 17:14320383-14320405 ATGCATGTGAAAAGGCAAGGAGG + Intronic
1144552480 17:16253322-16253344 ATGCCTATTAAAGTGCATGGGGG + Intronic
1145354386 17:22127371-22127393 ATGCATATTAAAAAATAAAAAGG - Intergenic
1147027132 17:37596587-37596609 ATGCATATTAAAAAACAGTATGG + Intronic
1148318870 17:46731904-46731926 AAACATTTTAAAAAGCAAGGTGG - Intronic
1149051178 17:52307168-52307190 ATGCAAATTAAACAACAATGAGG + Intergenic
1149462560 17:56842737-56842759 ATGAATATAAAAAAGAAAAGAGG - Intronic
1149775020 17:59350411-59350433 ATTCATATTTAAGAGCAATGGGG + Intronic
1150709276 17:67516231-67516253 ATGCAGATAAAAAGGCTAGGTGG - Intronic
1153159644 18:2189546-2189568 ATGCAAATGCAAAAGAAAGGAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154455121 18:14514671-14514693 ATGCATATTAAGAAGAAAACTGG + Intronic
1155383869 18:25255341-25255363 ATACAAAGTAAAAAGGAAGGTGG + Intronic
1156522530 18:37733896-37733918 ATGTATATTTAAAGGGAAGGTGG + Intergenic
1156831467 18:41497249-41497271 ATGCAAATTAAAGAGAATGGTGG - Intergenic
1157388818 18:47283793-47283815 ATGCCGACTAAAAAGCATGGTGG + Intergenic
1158254505 18:55530665-55530687 ATATATATTTAAAAGCCAGGAGG + Intronic
1158497198 18:57967201-57967223 ATCCATATGAAAAAGTAAAGTGG + Intergenic
1158513801 18:58114483-58114505 ATGGATTTTAAAAAGCAAGACGG - Intronic
1159270230 18:66139819-66139841 ATTCATATTAAAATGCAAATGGG - Intergenic
1159915668 18:74185422-74185444 CTGCATAATAAAAATTAAGGTGG - Intergenic
1160212474 18:76893812-76893834 ATTCACATAAAAAAGAAAGGTGG - Intronic
1160603466 18:80032302-80032324 AAGCATTTTAAAAAGGAATGTGG - Intronic
1162837026 19:13326859-13326881 ATGCATATTTCAAAGTAAGGTGG - Intronic
1164035787 19:21453432-21453454 ATGCATAATAAAAATCTAAGTGG - Intronic
1164268439 19:23645124-23645146 ATGTATATAAAAAATCAAAGTGG - Intronic
1165226191 19:34356981-34357003 GTTCATATTAAAAAGCTAGCAGG + Intergenic
1165759707 19:38313766-38313788 CTGCATATTCAAAAGCCAGTGGG - Intronic
1166023435 19:40055232-40055254 GTGAATATTAAATGGCAAGGTGG + Intronic
1166239537 19:41480525-41480547 GTGCATATTCAAAGGCTAGGTGG + Intergenic
1166955841 19:46464274-46464296 ATAAAAATAAAAAAGCAAGGAGG - Intergenic
1168480217 19:56713759-56713781 TTCCATAATAAAAAGCAGGGAGG - Intergenic
926504521 2:13696494-13696516 ATGTATATTAAAAAACAATTTGG + Intergenic
926827044 2:16915724-16915746 ATGTTTTTTAAAAAGGAAGGAGG - Intergenic
926872072 2:17431526-17431548 GTGCAAATTAGAAAGCAATGGGG + Intergenic
927555401 2:24027640-24027662 AAGCACATTAAAAAGGAAAGAGG + Intronic
927777374 2:25912706-25912728 ATGCATTTCAGAAAGGAAGGGGG - Intergenic
929904401 2:46033529-46033551 CTGCATTTTAAAATGCAAGGTGG + Intronic
930157984 2:48125097-48125119 ATGCACATTATCAAGGAAGGAGG + Intergenic
930508763 2:52317927-52317949 ATGTAGATTAAAAAATAAGGTGG - Intergenic
931640744 2:64379115-64379137 AGCCATATTAGAAAGCAAAGCGG - Intergenic
931851389 2:66254804-66254826 ATGGATGTTAAAAATCAAAGAGG + Intergenic
931965368 2:67527898-67527920 TTGCTTATTAAAATGCAACGTGG + Intergenic
932555364 2:72819240-72819262 ATGCATATAAAAAAGTTAAGAGG + Intronic
932600034 2:73117419-73117441 ATGCAAATGAAACAACAAGGAGG - Intronic
932976349 2:76603942-76603964 ATGCAAATTAGAAAGCAAACTGG + Intergenic
933177375 2:79190820-79190842 ATACATTTTAATAAGCCAGGGGG + Intronic
933426281 2:82115830-82115852 ATGGAAGGTAAAAAGCAAGGTGG + Intergenic
935383802 2:102480224-102480246 ATGCATATAAAAAATACAGGAGG - Intronic
935807375 2:106762416-106762438 ATGTTTATTAAAAAGTAAAGAGG - Intergenic
937654144 2:124355821-124355843 ATGGATATTGAAGAGGAAGGAGG + Intronic
938333478 2:130466634-130466656 ATGCATATTAAAAATAAAACTGG + Intronic
938356335 2:130654037-130654059 ATGCATATTAAAAATAAAACTGG - Intronic
938815173 2:134895558-134895580 ATTCATATGAAAACGCAAGGGGG + Intronic
939160477 2:138582901-138582923 ATGCACATTAAGAAGCAAAATGG - Intergenic
939759670 2:146158726-146158748 ATGAATAAGAGAAAGCAAGGAGG - Intergenic
939779694 2:146430591-146430613 ATGCATCTAAAAAATCAAGAGGG + Intergenic
939971946 2:148671808-148671830 ATGCAACTAAAAATGCAAGGAGG - Intronic
940647866 2:156410362-156410384 AGGCATAACACAAAGCAAGGAGG + Intergenic
941915351 2:170809298-170809320 ATGTTTATGAAACAGCAAGGAGG + Intergenic
942201683 2:173577730-173577752 ATGCCTATTGAAAAGCACTGTGG + Intergenic
942710437 2:178828732-178828754 ATACTTATTACAAAGCGAGGTGG + Intronic
943068959 2:183119046-183119068 ATGCATATTAAGAGGCAAAATGG - Intronic
944072170 2:195684047-195684069 ATGCATATTTAAAAGAAACTGGG + Intronic
944234723 2:197431474-197431496 ATGAAAAATAAAAATCAAGGAGG - Intronic
944241857 2:197493606-197493628 ATGCATATGAGAAATGAAGGAGG - Intronic
945497673 2:210529020-210529042 ATGCATATTTGAATGCAAGATGG + Intronic
946650386 2:221886923-221886945 ATGCTTGTTACACAGCAAGGTGG + Intergenic
947165655 2:227258983-227259005 TAGCATATGAAAAAGCAAAGAGG + Intronic
1169405817 20:5320278-5320300 ATACATATTAAAAAGCCTTGAGG + Intergenic
1169557282 20:6764765-6764787 ATGTATGCTAAAAAGCAAAGAGG + Intergenic
1169764608 20:9135570-9135592 ATACCTATAAAAAATCAAGGTGG - Intronic
1170616453 20:17956418-17956440 ATGCAAATTAAAAACAAAGCTGG + Intronic
1171060302 20:21950620-21950642 TTGGATTTTAAAAAGCTAGGAGG + Intergenic
1172895184 20:38295278-38295300 ATGCATCTTCAAAGGCATGGAGG + Intronic
1176819047 21:13638607-13638629 ATGCATATTAAGAAGAAAACTGG - Intronic
1177278447 21:18947443-18947465 ATGCTCATTAAAAAGCAAAATGG + Intergenic
1177903868 21:26951472-26951494 ATGTCTAGTAAAAAGGAAGGGGG + Intronic
1178556745 21:33597913-33597935 TTGTACATTAAAAAGTAAGGAGG - Intronic
1178619295 21:34159835-34159857 ATGCAATTCAAAATGCAAGGCGG - Intergenic
1178744854 21:35239315-35239337 ATTCATATTGAAATGCAAGAAGG + Intronic
1179915492 21:44475328-44475350 AAGCACATTAAGAAGCAAAGTGG + Intergenic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
1183148698 22:36019413-36019435 ATGCAGATTAAACAGTAAGCAGG + Intronic
1183200632 22:36383648-36383670 ATTTATATTAAAAAAAAAGGGGG + Intronic
1183848841 22:40566066-40566088 ATGCAAGTTAAAAAGCCATGAGG + Intronic
1184984601 22:48121105-48121127 ATACATATTTAAAAGGAAGGAGG - Intergenic
951194710 3:19811401-19811423 ATTTATATTTAAAAGCAATGTGG + Intergenic
951635302 3:24767786-24767808 TTGCATATTAAAAGGCTGGGGGG + Intergenic
951669579 3:25165313-25165335 ATGTATACAGAAAAGCAAGGTGG - Intergenic
951944845 3:28124244-28124266 ATACATATTAAAATGTAAGCAGG + Intergenic
952055245 3:29436136-29436158 ATGCTTTTTAAAAAGCCATGAGG + Intronic
953628573 3:44591662-44591684 ATGAAGATTAAATAGCAATGTGG + Intronic
956567280 3:70652939-70652961 AGGCATAATAAAAAGCAAGCAGG - Intergenic
956984018 3:74675656-74675678 TTGAAGGTTAAAAAGCAAGGAGG - Intergenic
957456628 3:80459880-80459902 ATGCATTTTCAAAAGTTAGGTGG - Intergenic
958151230 3:89697092-89697114 ATGCATATTAAGAGGCAAAATGG + Intergenic
958680697 3:97327591-97327613 GTGATTATTAAAAAGCAACGTGG - Intronic
959294762 3:104521528-104521550 ATGCACATTAAGAAGCAAAATGG - Intergenic
959951096 3:112181160-112181182 ATGAATAGTAAAGAGGAAGGTGG + Intronic
961500681 3:127331485-127331507 ATTCATATCATAAAACAAGGGGG + Intergenic
962026776 3:131556071-131556093 ATGGATATTAAAAAGCAATGGGG + Intronic
964665769 3:159170286-159170308 AAGCATATTGGAAAGCAAGGAGG + Intronic
965493398 3:169367502-169367524 ATAAATATTTAAAAGCAAGAAGG + Intronic
965687242 3:171317253-171317275 AAGTATATTAACAATCAAGGTGG + Intronic
965780742 3:172283320-172283342 ATGTGTATTTGAAAGCAAGGTGG + Intronic
965921493 3:173921026-173921048 AGGCATCTTAAAAAGTAAGTTGG - Intronic
966043876 3:175526885-175526907 ATGCTAATAAAAAAGCCAGGAGG - Intronic
966126850 3:176587942-176587964 ATGTAAATTAAAAAGAAAGTTGG + Intergenic
966230863 3:177650294-177650316 AAGTATAATCAAAAGCAAGGTGG + Intergenic
966493517 3:180554559-180554581 GTGAACATTAAAAAGCAAGAAGG + Intergenic
967806935 3:193722873-193722895 ATGCAGATTAAAAAGGATGGGGG + Intergenic
968143152 3:196274881-196274903 ATGCAAATTAAAATGGAAGAAGG + Intronic
969266321 4:6066444-6066466 ATGCATATTAAAAAGCAAGGAGG - Intronic
969980820 4:11152130-11152152 ATACAGATTAAAAAGCAAGTTGG - Intergenic
970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG + Intergenic
970798641 4:19945886-19945908 ATGCATATTAAGAGGCAAAATGG + Intergenic
970935281 4:21562605-21562627 TTGCATATTAAATAGAAATGAGG + Intronic
971426496 4:26521099-26521121 AACCATAGTAAAAATCAAGGAGG + Intergenic
971677696 4:29655119-29655141 ATTCATATGAAAAAGCAATTTGG - Intergenic
972176589 4:36415317-36415339 CTCCAAATTTAAAAGCAAGGAGG - Intergenic
972249625 4:37286489-37286511 ATGCATATTTAAATGCAAATTGG - Intronic
973632468 4:52832551-52832573 ATGCTAAAGAAAAAGCAAGGAGG - Intergenic
974310555 4:60203789-60203811 ATAAAAATTAAAAAGCAAGGAGG - Intergenic
975616826 4:76255432-76255454 ATTCTTATTAAAACACAAGGAGG + Intronic
975992680 4:80275450-80275472 TTTCATATTAACAAGCAGGGAGG + Intronic
976143237 4:82015124-82015146 ATACATATAAAGAAGCAAGAAGG + Intronic
976519513 4:86009622-86009644 AAGCAGGTTAAAAAGTAAGGTGG - Intergenic
976520262 4:86018304-86018326 ATGCATATAGAAAAGCCAGTAGG + Intronic
977504108 4:97879738-97879760 ATGCATATTAAAACACAATAGGG + Intronic
978033395 4:103964929-103964951 ACTCATATTAAAAAGAAAAGAGG - Intergenic
978270253 4:106880408-106880430 ATGTATATTAAAATGAAAGTTGG + Intergenic
978880787 4:113700296-113700318 ATTCATAATAAAGACCAAGGAGG + Intronic
978945900 4:114495715-114495737 TTGCATATTAAAAGACTAGGTGG - Intergenic
979580217 4:122349759-122349781 ATACAAATTAAAAAGCTGGGCGG + Intronic
980710998 4:136567441-136567463 ATGCTTAATAAAAAAAAAGGAGG - Intergenic
981241897 4:142487192-142487214 AATCATGTTAGAAAGCAAGGAGG - Intronic
981853550 4:149259650-149259672 AAGCCTATTAAAAAGTAAAGTGG - Intergenic
982669445 4:158302566-158302588 ATGCATATTGAAAGGCAGGGTGG - Intergenic
983038729 4:162899007-162899029 ATGCACATTAAGAAGCAAAATGG - Intergenic
983317805 4:166154563-166154585 AGGCATATTATGAAGAAAGGTGG - Intergenic
983418259 4:167485094-167485116 ATGCAGAATAAAAAGCAAAATGG - Intergenic
983603782 4:169561408-169561430 ATGCATTTTATAGAACAAGGTGG + Intronic
983937990 4:173516483-173516505 ATGCGTATTAAAAGGCAAGCAGG + Intergenic
984539115 4:181015185-181015207 ATTTATTTTAAAAAGCAAAGGGG - Intergenic
987150202 5:15030999-15031021 ACACATTTTAATAAGCAAGGAGG - Intergenic
988131207 5:27108607-27108629 ATGCACATTAAAATGCAAAATGG - Intronic
989547763 5:42694187-42694209 AACCATATTACAAAGCAATGTGG - Intronic
990491601 5:56308395-56308417 AAGCATATCAAAAGGCAAGATGG - Intergenic
990932129 5:61104437-61104459 ATGTATATTAAAAATGAAGTAGG - Intronic
991724482 5:69522611-69522633 ATTTATCTTAAAAAACAAGGGGG - Intronic
991929692 5:71741416-71741438 ATGCAGATTAAAACACAATGAGG - Intergenic
992143191 5:73819842-73819864 CTGCATCTTAAACAGCAAGTTGG - Intronic
993070597 5:83157962-83157984 ATTCTTAATAAAAAGCAAGTGGG - Intronic
993374963 5:87140079-87140101 ATGCATACTGAAAAGACAGGTGG + Intergenic
993853682 5:93044158-93044180 ATACATTTCAAATAGCAAGGTGG + Intergenic
994021952 5:95037328-95037350 ATGCTTAGGAAAAAGCAACGAGG + Intronic
994293919 5:98065812-98065834 CTGCAATTTAAAGAGCAAGGAGG - Intergenic
995043666 5:107619391-107619413 AAGCAAATTAAAATGCAAGAAGG + Intronic
995478441 5:112571195-112571217 AAGCATTTTTAAAAGGAAGGGGG + Intergenic
995630276 5:114125465-114125487 ATGTATATTCTAAAGCAAGTAGG + Intergenic
997652091 5:135529826-135529848 AACCATAGTAGAAAGCAAGGAGG - Intergenic
998022869 5:138785892-138785914 ATGCATTTTAAAAATAAATGTGG - Intronic
998335606 5:141369572-141369594 AAGTATAGTAAAAAGCAAGAGGG - Intronic
998609996 5:143678008-143678030 ATCCAAATTAAATAGCAAGTTGG - Intergenic
998770106 5:145533448-145533470 CTGAATACTAAAAATCAAGGTGG + Intronic
999431481 5:151528760-151528782 TTGCATATTTAAATGCAAAGAGG + Intronic
1000318253 5:160113855-160113877 TTGCATATTAGAAAGCTAGTTGG - Intronic
1000602151 5:163287783-163287805 ATAAATATTTAAAAGGAAGGAGG + Intergenic
1001013260 5:168117739-168117761 ATGCCTATTAAAAAGGAAGTGGG - Intronic
1002887334 6:1309355-1309377 ATGGAAATTAAAGGGCAAGGGGG + Intergenic
1003067690 6:2917746-2917768 TTACACATAAAAAAGCAAGGTGG + Intergenic
1003113233 6:3266016-3266038 ACACCTATGAAAAAGCAAGGCGG - Intronic
1003334091 6:5154508-5154530 ATACAGATTAAAAAGAAAGGCGG + Intronic
1003411875 6:5872147-5872169 ATGAATATGGAAAAGCTAGGTGG - Intergenic
1003757101 6:9134355-9134377 ATGCACATTAAAAGGCAATGGGG - Intergenic
1004947429 6:20630905-20630927 ATGCATTTGAAAATGCAAGTGGG + Intronic
1006641696 6:35492613-35492635 AAGCACATTAATAAGCAGGGCGG - Intronic
1008249603 6:49223919-49223941 ATTGAAATTAAAAAGAAAGGAGG - Intergenic
1008413253 6:51207948-51207970 GTGCATAATAAAAAGGAAGACGG - Intergenic
1008808401 6:55460739-55460761 ATCCATATCTAAAAGTAAGGGGG + Intronic
1008928737 6:56914846-56914868 AACCATATGAAAAAGCAAAGTGG + Intronic
1009446107 6:63744270-63744292 ATGCATTTTAAAAAGGAAAAAGG + Intronic
1009863045 6:69360332-69360354 ATGCATATTGAAAATTAATGAGG - Intronic
1009898287 6:69780087-69780109 TGGCATATTAAAAGGCTAGGTGG + Intronic
1010648589 6:78424314-78424336 TTGCATATTAAAAAGCTAGGTGG - Intergenic
1011175916 6:84559976-84559998 AGGCATATTATAAAGGAAAGCGG - Intergenic
1012327961 6:97947111-97947133 ATGGAAAATAAAAAGAAAGGAGG + Intergenic
1012532573 6:100255819-100255841 GTGCATACTAGAAAGAAAGGGGG + Intergenic
1012719851 6:102727113-102727135 ATGCATTTTAAAATGCAATTTGG - Intergenic
1014536927 6:122625470-122625492 ATGTAAATTAAAAAGCTATGGGG + Intronic
1014634750 6:123831593-123831615 ATGCATATTTAACAGCAGAGGGG - Intronic
1014954900 6:127602531-127602553 CTTCATCTTAACAAGCAAGGGGG + Intergenic
1015389854 6:132669443-132669465 ATGGAGGTTAAAAAGCAAAGTGG + Intergenic
1015441155 6:133248269-133248291 TTTCATTTTAAAAAGAAAGGGGG - Intronic
1015645181 6:135379770-135379792 ATGCATTTTGAACAGCAAAGAGG - Intronic
1015697234 6:135994169-135994191 ATGTATATTAAGAAGGGAGGTGG + Intronic
1015889490 6:137955390-137955412 TGGCATATTAAAAGGCTAGGTGG - Intergenic
1017071878 6:150582357-150582379 ATTCATATTAATAAAGAAGGGGG + Intergenic
1018070740 6:160162206-160162228 TTGCAAATTAAACAGGAAGGAGG + Intergenic
1018184844 6:161257702-161257724 ATGGAAATTAAAAAGGAATGTGG + Intronic
1018954441 6:168398754-168398776 ATACAAATTAACAACCAAGGGGG + Intergenic
1022053613 7:26705274-26705296 ATGTATATTAAAATGCAATTTGG + Intronic
1022488211 7:30796513-30796535 AAGCATTTTAAAAAGCAGGGTGG + Intronic
1023295882 7:38714766-38714788 AAGGATATTAAAAAAGAAGGAGG - Intergenic
1026258259 7:68731717-68731739 ATGCATATTAAGAGGCAAAATGG + Intergenic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1029695557 7:102210898-102210920 ATGCACATTCAAAAGGAACGTGG - Intronic
1030444710 7:109634953-109634975 CTGCATATTTAAATGCAAGCAGG + Intergenic
1030819571 7:114079601-114079623 ATGCGTCTTAGAAAGCAATGAGG + Intergenic
1031090852 7:117351759-117351781 ATGCATATTAAAAGACAAAATGG - Intergenic
1031749434 7:125553652-125553674 AAGCATAATAAAAATCAAGAAGG - Intergenic
1033770641 7:144547651-144547673 AAAAATATTAAAAAGTAAGGGGG - Intronic
1034708719 7:153171298-153171320 ATGCATATTAGAGGGCATGGCGG + Intergenic
1035134197 7:156684645-156684667 GTGCATTTTAAAATGCAAGTGGG - Intronic
1035485128 7:159217312-159217334 CTGCAGATTAAACAGCATGGTGG + Intergenic
1035598002 8:876112-876134 ATACATATGAAAAAGCTTGGTGG - Intergenic
1036180920 8:6584736-6584758 CTGCATTTGGAAAAGCAAGGAGG - Intronic
1036553664 8:9838344-9838366 ATTTATATTAAAAAGCAGAGGGG + Intergenic
1036724018 8:11202319-11202341 TTGCATATTAAAAAAAAAGTTGG - Intergenic
1037462103 8:19121414-19121436 ATGCCTATTAAACATCTAGGTGG - Intergenic
1038943498 8:32331559-32331581 ATGCATATTAAATTGTAAAGGGG - Intronic
1039241726 8:35564545-35564567 ATGCATATTAGAAAGTAAAGTGG - Intronic
1040456718 8:47605537-47605559 ATGCATATTTAAAAGAAAAATGG - Intronic
1041234081 8:55781324-55781346 AAGGTTATTTAAAAGCAAGGTGG - Intronic
1042012372 8:64261681-64261703 ATGCATTTTTATAAGCAAGAAGG + Intergenic
1042176790 8:66045386-66045408 ATGCATATTATCAAACAAGTTGG + Intronic
1042398499 8:68318305-68318327 ATGCAAGTTTAAAAGCAAAGGGG - Intronic
1042494203 8:69437755-69437777 TTCCATATGAAAAGGCAAGGAGG + Intergenic
1043212175 8:77535395-77535417 AAGAATCTTAAAATGCAAGGTGG + Intergenic
1043717097 8:83500200-83500222 ATGCACAGTAAAAACAAAGGTGG - Intergenic
1044427919 8:92074425-92074447 ATGCAGATTAAAAATCAAAAAGG - Intronic
1045800283 8:106093821-106093843 ATGAATTTTAAAAAATAAGGAGG - Intergenic
1046107711 8:109686301-109686323 AAACATATTAAAATGGAAGGTGG - Intronic
1046346740 8:112938806-112938828 ATGCAAATATATAAGCAAGGGGG + Intronic
1046633435 8:116644907-116644929 TTGCATATTGAAAAGCACAGAGG - Exonic
1046728661 8:117701476-117701498 ATGCAAATCAAAAGGCAATGGGG + Intergenic
1046824864 8:118677134-118677156 ATGCATCTTAAAAAAGAAGGAGG + Intergenic
1046836364 8:118806076-118806098 ATGCATATTCCGAAGCAGGGAGG + Intergenic
1047949427 8:129918110-129918132 ATGCATAGTTAAAAACAGGGTGG - Intronic
1048654901 8:136524945-136524967 ATGTATATGAAATAGCCAGGAGG - Intergenic
1048705490 8:137148453-137148475 ATGCTTATAGAACAGCAAGGCGG - Intergenic
1049871752 8:144984562-144984584 TTGGAAATTAAAAAGCATGGTGG + Intergenic
1050790057 9:9457195-9457217 CTTCATGTTAATAAGCAAGGAGG - Intronic
1055216969 9:73876156-73876178 ATTCATATTATAAAGAAAGATGG + Intergenic
1056435222 9:86569419-86569441 ATGCACATTAAGAAGCAAAATGG - Intergenic
1057444155 9:95102323-95102345 AGGCCTATTAAAAAGCAAGTAGG - Intronic
1057615300 9:96584167-96584189 ATGCATATTTATTAGCAAGCAGG - Intronic
1058278235 9:103074844-103074866 ATGCACATTAAAAGACAAGGTGG - Intergenic
1058561845 9:106238369-106238391 ATCCAAACTAAAAAGCAGGGAGG - Intergenic
1058858187 9:109087462-109087484 ATCAATGTTAAAAAGCAGGGTGG + Intronic
1058922205 9:109627786-109627808 AGGCATTTTAAAAAGTAAAGTGG - Intergenic
1060753634 9:126192321-126192343 ATGCATTTTTAATAGCAAGTAGG - Intergenic
1060869831 9:127030673-127030695 ATGCATGTTAAAATGCTAGCAGG + Intronic
1203528310 Un_GL000213v1:110893-110915 ATGCATATTAAGAAGAAAACTGG + Intergenic
1187253656 X:17622208-17622230 ATGAAATTTGAAAAGCAAGGGGG - Intronic
1188403695 X:29780169-29780191 ATGCACAGTAAAAAGGAAGATGG - Intronic
1189082030 X:37984024-37984046 ATGTATATTTAAAAGGAAAGAGG + Intronic
1189245390 X:39559515-39559537 ATGCATATTGAAAAAAAATGTGG - Intergenic
1190394908 X:49972084-49972106 ATGCATATGATAAAGCAAATAGG - Intronic
1190498074 X:51046377-51046399 ATGCAAATTAACAGCCAAGGAGG + Intergenic
1190632582 X:52402059-52402081 ATGCATTTTAAAATGCAATTTGG + Intergenic
1190937542 X:55009969-55009991 ATGCATATTAGACATCTAGGTGG - Intronic
1193915818 X:87362185-87362207 AGGCATATAAAAATGCTAGGAGG - Intergenic
1195979531 X:110562276-110562298 ATGCCTATATAAAAGAAAGGGGG - Intergenic
1196929938 X:120671529-120671551 ATGCATTTTTAAAAGCGTGGGGG - Intergenic
1197462833 X:126763878-126763900 ATGCAGATTAAAAAGGTAGTGGG - Intergenic
1197912741 X:131502295-131502317 CTGAATTTCAAAAAGCAAGGAGG + Intergenic
1199233591 X:145467153-145467175 ATGCATTTGAGACAGCAAGGTGG + Intergenic
1201586028 Y:15562209-15562231 AAGCATATTAAAATGTGAGGTGG - Intergenic