ID: 969268887

View in Genome Browser
Species Human (GRCh38)
Location 4:6085446-6085468
Sequence AGAGCTCCCGCCCGGGATCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969268887_969268893 -5 Left 969268887 4:6085446-6085468 CCCCGATCCCGGGCGGGAGCTCT 0: 1
1: 0
2: 0
3: 4
4: 57
Right 969268893 4:6085464-6085486 GCTCTCTCTTTGGACTACTGTGG 0: 1
1: 0
2: 0
3: 11
4: 154
969268887_969268894 5 Left 969268887 4:6085446-6085468 CCCCGATCCCGGGCGGGAGCTCT 0: 1
1: 0
2: 0
3: 4
4: 57
Right 969268894 4:6085474-6085496 TGGACTACTGTGGTGCCGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969268887 Original CRISPR AGAGCTCCCGCCCGGGATCG GGG (reversed) Exonic
900166672 1:1246763-1246785 AGAGCCCCCGCGCGGGGGCGAGG + Intergenic
902929860 1:19723397-19723419 AAAGCTCCAGCCCTGGATCTGGG - Intronic
921556166 1:216601158-216601180 CGAGCGCCCGCCCGGGAGCCCGG - Intronic
922757211 1:228103073-228103095 CCAGCGCCCGCCCGGGATCCCGG + Intronic
1077152514 11:1078580-1078602 ACAGCTCCCACCCGGGCTTGGGG - Intergenic
1084888177 11:72223982-72224004 AAAGTTCCCTCCCGGGATCCCGG - Intronic
1089712409 11:120325305-120325327 GCAGCTCCCGGCCCGGATCGCGG - Exonic
1090945733 11:131428047-131428069 AGATCTCTCCCCTGGGATCGAGG + Intronic
1092384715 12:8027144-8027166 TCAGCTCCGGCCCGGGAACGTGG - Intergenic
1102256612 12:111418841-111418863 AGAGCTCCAGCACGCGGTCGGGG - Exonic
1102375685 12:112419219-112419241 CGGGCTCCCGCCCCGGGTCGGGG + Intronic
1103141698 12:118554305-118554327 AGAGCTCCCACCAGGGACTGCGG + Intergenic
1105273491 13:18900209-18900231 GGAGCTCCTGCCTGGGATCAGGG - Intergenic
1106249214 13:27971312-27971334 AGAGCTCAGGCCTGGGAGCGGGG - Intergenic
1107779080 13:43879421-43879443 AGGGCTCTCGCCCGGGAGCCAGG - Exonic
1119296540 14:73537760-73537782 ACAGCAGCCGCCCGGGGTCGGGG - Exonic
1119300784 14:73569765-73569787 ACAGCAGCCGCCCGGGGTCGGGG - Exonic
1119461699 14:74810341-74810363 AGAGATCGAGACCGGGATCGTGG + Exonic
1122486682 14:102086852-102086874 AGCGCGGCCGCCCGGGAGCGCGG + Intronic
1122974609 14:105165983-105166005 ACAGCTCCCGCCCGGCAGCCAGG + Intronic
1125505332 15:40264738-40264760 TGAGCTCCCTCCCGGGAAAGAGG - Intronic
1131431808 15:92394188-92394210 AGAGATCCCGCCAGGGCTCGTGG - Intronic
1132838092 16:1964701-1964723 AGGGCTCCCGCCCAGGAGCGCGG + Intronic
1133108076 16:3527056-3527078 AGAGCTCCTTCCCGGAATCTAGG - Intronic
1136371863 16:29841655-29841677 AGAGCTGCCTCCCGGGGTGGAGG + Exonic
1136480000 16:30535049-30535071 AGAGCTTCCGCCCGGGTTTGCGG + Intronic
1138193200 16:55033467-55033489 AGCGCTCCCGCCCTGGAACGTGG + Intergenic
1139632174 16:68237380-68237402 AGAGCTCATGCCCGGGAAAGGGG + Intronic
1142560206 17:805122-805144 AGAGCTCCAGCACGGGCTTGGGG + Exonic
1147578150 17:41614215-41614237 AGACCTCCTGCCAGTGATCGTGG - Intronic
1150488527 17:65560097-65560119 CGACCCCCCGCCCGGGCTCGGGG - Intronic
1157610114 18:48950635-48950657 GGGGCGCCCGCCGGGGATCGGGG + Exonic
1160815015 19:1031103-1031125 AGAGCTCCGCACCTGGATCGAGG + Exonic
1161203591 19:3029070-3029092 AGCGCGCGCGCCCGGGGTCGTGG + Exonic
1161260965 19:3337507-3337529 AGAGCACCCACCAGGCATCGTGG - Intergenic
1165850764 19:38849327-38849349 AGTGTTCCCGCCCGGCCTCGTGG - Intronic
941021070 2:160408031-160408053 CGCTCTCCCTCCCGGGATCGGGG + Intronic
948621736 2:239239594-239239616 AGAGCTCCCTGCCAGGAACGAGG + Intronic
948622911 2:239247814-239247836 AGAGATCCCTCCCTGGAGCGAGG + Intronic
1181120413 22:20664224-20664246 GGAGCTCCTGCCTGGGATCAGGG + Intergenic
950548967 3:13655148-13655170 AGAGCGACCACCCGGGATCAGGG - Intergenic
950829244 3:15859017-15859039 ACCGCTCCCGCCCGGCAGCGGGG + Intronic
953773383 3:45796118-45796140 AGAGCTCCGGCTCCGGAACGAGG + Intronic
954756552 3:52843511-52843533 AGGGCTCCCGTCCAGGATGGAGG - Intronic
961330845 3:126137050-126137072 AGAGCTCCCGCCAGGCAGCCTGG - Intronic
962309065 3:134313052-134313074 GGAGCTCCCGCCGGGGCTCCCGG - Intergenic
963960632 3:151305214-151305236 AGGATTCCCGCCCGGGATCCAGG - Intronic
969268887 4:6085446-6085468 AGAGCTCCCGCCCGGGATCGGGG - Exonic
970666992 4:18348105-18348127 AGAGCTCCCATCTGGGATCAGGG - Intergenic
995077539 5:108004600-108004622 AGTACTCCAGCCTGGGATCGAGG + Intronic
1003603887 6:7542316-7542338 TGACCACCCGCCCGGGCTCGCGG - Intronic
1013575861 6:111483173-111483195 AGAGCTGCAGCCTGGGACCGAGG - Exonic
1024993808 7:55255676-55255698 AGAGCCCGCGCCCTGGAACGCGG + Intronic
1029278647 7:99423018-99423040 AGAGCTCTCGCCCGGTGTGGTGG - Intronic
1036788699 8:11703986-11704008 AGTGCTACCGCCAGGGAGCGGGG - Intronic
1038644903 8:29352865-29352887 AGAGCTCCGGCCCTGGGTCCTGG - Intergenic
1046167243 8:110452420-110452442 AGTGCTGCCGCCAGGGATTGGGG + Intergenic
1047615395 8:126558431-126558453 TGCGCTCCCGCCCGGGAGCCCGG - Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1057312019 9:93948777-93948799 AGGGCCCCGGCCCGGGATGGGGG - Intergenic
1188027578 X:25226589-25226611 AGAGCTGGGGCCCGGGATGGGGG - Intergenic
1189310386 X:40013920-40013942 ACAGCTCCCGCTCCGGACCGGGG + Intergenic