ID: 969269507

View in Genome Browser
Species Human (GRCh38)
Location 4:6089620-6089642
Sequence CTTGACTGCTTAGAAACAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969269507 Original CRISPR CTTGACTGCTTAGAAACAAC CGG (reversed) Intronic
900808851 1:4785906-4785928 CTTTAAAGCTTAGAAACAGCTGG + Exonic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
909224407 1:72998787-72998809 TGTGACTTCTTAGAAAAAACAGG + Intergenic
909709451 1:78629824-78629846 CTTGACTGAATTGAAAAAACTGG - Exonic
910713254 1:90203536-90203558 CTTGAGGGCTTATAAACAACAGG - Intergenic
911302120 1:96187199-96187221 TTTGACTGCTTAGTCACAAAGGG + Intergenic
914738549 1:150442683-150442705 GTTGCATGCTTAGGAACAACAGG + Intronic
918482173 1:184990689-184990711 CTGGATGGCTTATAAACAACAGG - Intergenic
918557890 1:185826587-185826609 TTTTACTGCTCAGAACCAACTGG - Intronic
918727467 1:187943696-187943718 CTTGGTAGCTTAGAAACAACAGG - Intergenic
919299184 1:195739080-195739102 CTTGCCTCCTTAGAAAAAAAGGG - Intergenic
924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG + Intronic
1062928445 10:1335605-1335627 CTTGACTGCTTGCAAGCCACTGG + Intronic
1062930264 10:1348219-1348241 CCTGAGAGTTTAGAAACAACAGG - Intronic
1064745895 10:18477834-18477856 GTTGTCTGCTTAGGAACAAAAGG + Intronic
1067192247 10:44081557-44081579 CTTGACTGCTTGGGGACAACAGG + Intergenic
1069470608 10:68686145-68686167 CTGGTCTGCCTACAAACAACTGG + Intronic
1070838834 10:79469125-79469147 GTTTACTGCTTAGAAACAAATGG - Intergenic
1070976111 10:80607153-80607175 ATCGACTGCTTAGAAACAGAGGG + Intronic
1071879813 10:89884290-89884312 CTTGATACCTTAGAAACATCTGG - Intergenic
1072370864 10:94765400-94765422 CTTGGCTGGGTAGACACAACTGG + Intronic
1075788458 10:125066373-125066395 CCTGACTGCTTAGAAGGCACGGG - Intronic
1075908207 10:126101035-126101057 CTTGTCTGCTTAAAAAAAAAAGG - Intronic
1076299765 10:129416155-129416177 CTTAAATGATAAGAAACAACTGG + Intergenic
1077865919 11:6221763-6221785 CTAGAGTGCTTAGAAATAATAGG - Intronic
1077873109 11:6279959-6279981 CGTGACTGAATAGAAACAACAGG + Intergenic
1083614503 11:64019540-64019562 CCTGAGTGCTCAGAAACGACAGG + Intronic
1091247401 11:134109870-134109892 GCTGTCTGCTTAGAAACAAATGG + Intronic
1091924307 12:4332203-4332225 CTTGAATGCTTATACACAAAAGG - Intronic
1094135503 12:27120909-27120931 TTTGGCTGCTTAGAAACAGAGGG + Intergenic
1098860922 12:75708952-75708974 CTTGACTCCTGAAAAACAAAGGG + Intergenic
1099441700 12:82707096-82707118 CTAGGCAGCTTATAAACAACAGG + Intronic
1102718615 12:114996842-114996864 CTTGGTGGCTTATAAACAACAGG + Intergenic
1103375992 12:120456420-120456442 GTTGGCTGCTAAGTAACAACTGG - Intronic
1104143027 12:126006506-126006528 CTATACTGCCTAGAAACAAAGGG - Intergenic
1109169924 13:59082618-59082640 CTTGACTGCAAAGAAAAAATGGG + Intergenic
1109692331 13:65909789-65909811 CTTGCCTGGCTAGAAACAGCAGG + Intergenic
1110079355 13:71291215-71291237 CTTGATTGGTTAAAAACATCAGG + Intergenic
1111222738 13:85225975-85225997 CTTGACTACATAGAAGCAATAGG - Intergenic
1111764450 13:92510461-92510483 CTCAGCTGCATAGAAACAACTGG + Intronic
1116524943 14:45892456-45892478 CTTGGCTGTTTAGAATCAGCAGG + Intergenic
1117673640 14:58133167-58133189 CTTGACAGCTGAGTAACACCAGG + Exonic
1117818515 14:59623297-59623319 CTTGACAGCTTGGAAAGAATGGG - Intronic
1119908573 14:78328205-78328227 CTAGACTGCCTAGGAACAATTGG - Intronic
1120016964 14:79484815-79484837 TTTGCCTGCTCAGAAACATCTGG + Intronic
1120933998 14:89875530-89875552 CTTGACCACTTATAACCAACTGG - Intronic
1124342222 15:28897005-28897027 CCTGATTGCTTGGACACAACTGG + Intronic
1125878882 15:43174960-43174982 CCTGACTGCTTAGAATCACTGGG + Intronic
1126153401 15:45543226-45543248 CTTGGTGGCTTAGAAACAACAGG + Intergenic
1126338796 15:47616927-47616949 CTGAACTGCTAAGAAACAGCTGG + Intronic
1126942358 15:53780694-53780716 ATTTACTTCTTAGAAACAATGGG + Intergenic
1131900656 15:97084330-97084352 CTAGACTGTTTAGACAAAACTGG - Intergenic
1133858540 16:9572786-9572808 CTTTACTGATGAGAAAGAACAGG - Intergenic
1134559316 16:15194314-15194336 CTTGGTAGCTTATAAACAACAGG - Intergenic
1134919854 16:18105927-18105949 CTTGGTAGCTTATAAACAACAGG - Intergenic
1135378497 16:21972345-21972367 ATTGAATGCTTAGAAATAAAGGG + Intronic
1141422987 16:83928958-83928980 CTTGACAACTTGGAAACAAAAGG + Intronic
1146783457 17:35697075-35697097 CAAGGCTGCTGAGAAACAACAGG - Intronic
1149483229 17:57020292-57020314 GCTGTCTGCTTAGAAACAAAAGG - Intergenic
1149549242 17:57527685-57527707 CTTGGTTGCTTAGCAACAAAAGG + Intronic
1150089377 17:62308877-62308899 CTTCACTCCTTAGAAAAAAGAGG - Intergenic
1151159628 17:72153931-72153953 CTTGTCTGCATTCAAACAACAGG + Intergenic
1155996084 18:32332795-32332817 TTTAAGAGCTTAGAAACAACAGG - Intronic
1159772839 18:72568135-72568157 CGTGACTGGTTATACACAACAGG - Intronic
1167181115 19:47904172-47904194 CTTCACTGCATAGACAGAACAGG + Intergenic
1167183768 19:47925624-47925646 CTTCACTGCATAGACAGAACAGG + Intergenic
1167185070 19:47936025-47936047 CTTCACTGCATAGACAGAACAGG + Intergenic
1167185722 19:47941414-47941436 CTTCACTGCATAGACAGAACAGG + Intergenic
1167186389 19:47946769-47946791 CTTCACTGCATAGACAGAACAGG + Intergenic
1167187040 19:47952160-47952182 CTTCACTGCATAGACAGAACAGG + Intergenic
1167187690 19:47957543-47957565 CTTCACTGCATAGACAGAACAGG + Intergenic
1167542151 19:50096089-50096111 CTTCACTGCATAGACAGAACAGG - Intergenic
1167542586 19:50099154-50099176 CTTCACTGCATAGACAGAACAGG - Intergenic
1167543023 19:50102219-50102241 CTTCACTGCATAGACAGAACAGG - Intergenic
1167543459 19:50105282-50105304 CTTCACTGCATAGACAGAACAGG - Intergenic
1167544132 19:50110626-50110648 CTTCACTGCATAGACAGAACAGG - Intergenic
1167544807 19:50115979-50116001 CTTCACTGCATAGACAGAACAGG - Intergenic
1167545482 19:50121331-50121353 CTTCACTGCATAGACAGAACAGG - Intergenic
1167546159 19:50126686-50126708 CTTCACTGCATAGACAGAACAGG - Intergenic
1167546836 19:50132021-50132043 CTTCACTGCATAGACAGAACAGG - Intergenic
1167547494 19:50137394-50137416 CTTCACTGCATAGACAGAACAGG - Intergenic
927119235 2:19939759-19939781 CTTTACTGCTTTTAAACAAATGG - Intronic
927583425 2:24276750-24276772 CTTCCCTGCTCAGAAACGACTGG + Intronic
930851004 2:55960165-55960187 CTTGAATGCTTAGACTCAGCAGG - Intergenic
931114571 2:59150695-59150717 GTTCACTGCTTAGAAAGTACTGG - Intergenic
931901437 2:66793201-66793223 TTTGACTGCTTCTAAACAATGGG - Intergenic
932199948 2:69817100-69817122 CTTGCCTGGTTACAAATAACAGG + Intronic
932868967 2:75377409-75377431 CTTGACTTCTTTGAATCAGCAGG - Intergenic
933827331 2:86174411-86174433 CATGACTACTTAAACACAACAGG + Intronic
934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG + Intronic
935331956 2:101983600-101983622 CGGGATGGCTTAGAAACAACAGG - Intergenic
935507788 2:103928433-103928455 CTTTCCTTCTTAGAAACCACTGG + Intergenic
939484666 2:142796022-142796044 CCTGACTGCTTTAAAAGAACAGG - Intergenic
940416613 2:153430212-153430234 CATGACTTCTAAGAAACAAATGG + Intergenic
940449362 2:153818390-153818412 CTTGCCTGGTGAGAAACAGCGGG - Intergenic
942508943 2:176674889-176674911 CTTGAGTGCTAAAAAACAAGGGG + Intergenic
944633313 2:201649951-201649973 CTTAACTCCTCAGAAACAAAAGG + Intronic
944948592 2:204719843-204719865 TTTGAATACTTAAAAACAACAGG + Intronic
946439055 2:219679665-219679687 CTTGGTAGCTTATAAACAACAGG + Intergenic
948157541 2:235795535-235795557 CTTGAATGCTTTAAAACTACAGG - Intronic
1170136582 20:13080655-13080677 CTTCACTCCTTTGAAACTACGGG - Intronic
1173972945 20:47166536-47166558 CTTGACTACTGAGAAAAAATTGG - Intronic
1173973417 20:47169782-47169804 CTTGACTACTGAGAAAAAATTGG - Intronic
1174324549 20:49768805-49768827 CCTGACAGTTTAGAAACCACAGG + Intergenic
1174672404 20:52320359-52320381 CATGGCTGCTTTCAAACAACAGG - Intergenic
1176343797 21:5722480-5722502 CTAGACAGCTTATAGACAACAGG - Intergenic
1176501030 21:7601976-7601998 CTAGACAGCTTATAGACAACAGG + Intergenic
1176538118 21:8120549-8120571 CTAGACAGCTTATAGACAACAGG - Intergenic
1177277860 21:18938799-18938821 CTTGACTCTTTTGAAACAAGAGG - Intergenic
1185379440 22:50501341-50501363 CTTGAAAGCTTAGGAACATCAGG + Intergenic
1203243065 22_KI270733v1_random:36904-36926 CTAGACAGCTTATAGACAACAGG - Intergenic
951378510 3:21953633-21953655 CTTGAATGTTTAGAAAACACAGG - Intronic
952570502 3:34710509-34710531 CTTATCTGCTTAGAAACATGAGG + Intergenic
956381025 3:68664558-68664580 CTTCTCTGATTAGAAAAAACTGG - Intergenic
959123298 3:102258755-102258777 CTTGACTGATTAGAATCAGTGGG + Intronic
960041822 3:113157811-113157833 CTGGATTTCTTAGAAACATCTGG - Intergenic
960540048 3:118851836-118851858 CCTGACTGGTTAAAAACATCAGG - Intergenic
965777745 3:172250757-172250779 CTTGATTGGTTAGAAACAAATGG + Intronic
965857830 3:173110221-173110243 CTTGACAACTAAGAAACAATGGG + Intronic
967015612 3:185479024-185479046 CTAAGCTGCTTATAAACAACGGG + Intronic
969093311 4:4713100-4713122 CTAGATGGCTTATAAACAACAGG + Intergenic
969269507 4:6089620-6089642 CTTGACTGCTTAGAAACAACCGG - Intronic
970041240 4:11799318-11799340 CTTAACTTCATTGAAACAACAGG + Intergenic
972231084 4:37073532-37073554 CTTGATTGGTTAAAAACATCAGG + Intergenic
973819179 4:54647730-54647752 CTTTACTGTTTAGAACCAAAGGG - Intergenic
977709760 4:100111636-100111658 CTTGATGGCTTTGAAACCACAGG - Intergenic
987118287 5:14743729-14743751 CTGGAATGCTTGGAAACAATGGG + Intronic
988225479 5:28406800-28406822 CTGGATTACTTATAAACAACAGG - Intergenic
989075138 5:37557172-37557194 CTTTGCTGTTTTGAAACAACAGG - Intronic
989133712 5:38132272-38132294 ATTTACTGCTTAGACCCAACAGG + Intergenic
991599439 5:68337727-68337749 CTTGCCTCCTTAGAATCAAATGG + Intergenic
993044445 5:82851638-82851660 TTGGAATGCTTAGAAAAAACTGG - Intergenic
993143169 5:84059853-84059875 CTTCATTGCTTAGCAACCACAGG + Intronic
994024676 5:95069148-95069170 TATGACTGCTCAGAAACAAAGGG + Intronic
995192442 5:109331854-109331876 CTTGATGGCTAAGAGACAACAGG + Intergenic
997973593 5:138424839-138424861 CTATACAGCTTAGAAACAAGAGG - Intronic
998770632 5:145540662-145540684 ATTGACTTCTTAGAAAAAATGGG - Intronic
998882586 5:146658383-146658405 CATGACTTTTTAGTAACAACTGG + Intronic
1001163775 5:169344880-169344902 CCTGACTGTTTGGAAACCACTGG + Intergenic
1001774664 5:174320231-174320253 CCTGACTTCCTAGCAACAACAGG + Intergenic
1003799620 6:9648985-9649007 CTTGACTTCTTAGATACCTCTGG + Intronic
1004441262 6:15657235-15657257 CTTGACAGCTGAGAAGCAATTGG - Intronic
1007485143 6:42175750-42175772 CCAGACTGCCTAGAAACAAGGGG - Intronic
1010052415 6:71522708-71522730 CTTGAATGATTAGAAAAAAATGG - Intergenic
1011156843 6:84342713-84342735 CTGGATAGCTTATAAACAACAGG + Intergenic
1014209460 6:118692527-118692549 ATTGACTACTTTGAAACATCTGG + Intronic
1015337195 6:132053352-132053374 CTTGGTGGCTTAAAAACAACAGG - Intergenic
1024419416 7:49145037-49145059 TTTGAGTGCTTAGGAAAAACAGG - Intergenic
1024505126 7:50156368-50156390 GATGACTTCTTAGAAATAACAGG - Intronic
1028530835 7:91836994-91837016 CTTGTCTGCTTAGTAAGAAATGG + Intronic
1030761202 7:113354212-113354234 CTGGCCTGCTTACAAACTACAGG + Intergenic
1032908567 7:136402447-136402469 ATTGACTGCTTAGAATCTCCTGG - Intergenic
1037310485 8:17550413-17550435 TTTGACTGCATTGCAACAACTGG + Exonic
1038191585 8:25326003-25326025 CCTGACTGCTTGGAAAAAAATGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1045847978 8:106659262-106659284 TTTTACTGCTTTAAAACAACTGG - Intronic
1045858764 8:106792714-106792736 CTTGACTGAGTAGACAGAACTGG - Intergenic
1047972340 8:130095959-130095981 GTTGACTGATCAGAAACAAGTGG + Intronic
1048096040 8:131295625-131295647 CTTGACAGCTGAGAAACACCTGG + Intergenic
1048229644 8:132625739-132625761 CCTGACTGCTAAGAATCACCTGG + Intronic
1053570164 9:39296369-39296391 TTTGAATGCTTAGACACTACTGG + Intergenic
1053836117 9:42137326-42137348 TTTGAATGCTTAGACACTACTGG + Intergenic
1054091791 9:60855379-60855401 TTTGAATGCTTAGACACTACTGG + Intergenic
1054113205 9:61130969-61130991 TTTGAATGCTTAGACACTACTGG + Intergenic
1054126984 9:61322637-61322659 TTTGAATGCTTAGACACTACTGG - Intergenic
1054594502 9:67051197-67051219 TTTGAATGCTTAGACACTACTGG - Intergenic
1055147564 9:72955131-72955153 CTTTTCTGCCTAGAAACCACAGG + Intronic
1055915619 9:81397172-81397194 CTTGCCTTCTTTGAAACAAGAGG - Intergenic
1059075609 9:111190633-111190655 CTTGACTGATGATAAACACCAGG + Intergenic
1060162423 9:121377205-121377227 CTTGACTGCTTGGAGACATCAGG + Intergenic
1060680504 9:125558974-125558996 CATCACCGCTTTGAAACAACAGG + Intronic
1203459390 Un_GL000220v1:19987-20009 CTAGACAGCTTATAGACAACAGG - Intergenic
1185447067 X:264107-264129 CTTCCCTGCGTGGAAACAACAGG + Intergenic
1186048095 X:5557996-5558018 CTTGACTTCTATGAATCAACTGG - Intergenic
1194886118 X:99318251-99318273 TTTGACTTCTTTGAAACCACAGG - Intergenic
1195251716 X:103054081-103054103 CTTTAATGCTTAGAAATAATGGG - Intergenic
1196753975 X:119141935-119141957 CATATCTGCTTAGAAACTACTGG - Intronic
1197627407 X:128817696-128817718 ATTGACTGCTTAGAATCAGAAGG + Intergenic
1198458449 X:136840005-136840027 CTTGACAACTTAGAAGAAACTGG - Intergenic
1198471030 X:136947105-136947127 CTTGACTGTTGAGGAACAAGGGG - Intergenic
1201406857 Y:13658499-13658521 CTTGACTGGTAAGACAGAACTGG + Intergenic
1201743692 Y:17348980-17349002 CTTGGCTGGGTAGACACAACTGG + Intergenic