ID: 969272398

View in Genome Browser
Species Human (GRCh38)
Location 4:6111690-6111712
Sequence AAGCACGGGCTGTCACAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969272398_969272403 4 Left 969272398 4:6111690-6111712 CCCCTCTGTGACAGCCCGTGCTT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 969272403 4:6111717-6111739 TAGACTGCCAGCACCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969272398 Original CRISPR AAGCACGGGCTGTCACAGAG GGG (reversed) Intronic
900265768 1:1756366-1756388 AAGAAGAGGCTGTCACACAGTGG + Intronic
902622921 1:17660761-17660783 AAGAATGGGCTGTCATACAGGGG + Intronic
907384701 1:54118438-54118460 GAGCAAGGCCTGTTACAGAGTGG - Intergenic
910133136 1:83933241-83933263 AAGCCCAGGCACTCACAGAGAGG + Intronic
911714481 1:101115369-101115391 CAGCTAGGGGTGTCACAGAGTGG - Intergenic
912747857 1:112260430-112260452 AGGCCCTGGCTATCACAGAGAGG - Intergenic
923203885 1:231739470-231739492 ATGCAGGGGCTGCCACACAGAGG - Intronic
1062975178 10:1677708-1677730 CAGCTTTGGCTGTCACAGAGGGG + Intronic
1064761395 10:18625093-18625115 AAACACAGGCTGTCTCAGTGAGG - Intronic
1064762445 10:18635220-18635242 AAACACAGGCTGTCTCAGTGAGG - Intronic
1068936363 10:62639204-62639226 GAGCAATGGCTGGCACAGAGTGG - Intronic
1070361418 10:75693381-75693403 TAGCACAGGTTGTCACAAAGAGG - Intronic
1070730034 10:78820512-78820534 TAACACTGCCTGTCACAGAGTGG - Intergenic
1073609968 10:104933524-104933546 AAGCACAGGCCCACACAGAGAGG + Intronic
1077213017 11:1382259-1382281 AAGCAGAGCCTGTCACAGTGGGG - Intergenic
1079051890 11:17168104-17168126 AGGAACTGGCTGTCACTGAGAGG - Intronic
1079603737 11:22341613-22341635 AAGCACGTGCAGTCGCACAGCGG - Exonic
1080693281 11:34577952-34577974 AAGCACGGGTAGGCACAGTGGGG + Intergenic
1084325608 11:68398142-68398164 AAACACGTGCTGTCAGAGGGTGG + Intronic
1084760974 11:71270653-71270675 AACCAGGGCCTTTCACAGAGTGG + Intergenic
1085792850 11:79510893-79510915 TAGCACGGCCTGTCTCTGAGTGG + Intergenic
1091364362 11:135005271-135005293 AGGCACGCACTGTCTCAGAGCGG - Intergenic
1093223029 12:16446711-16446733 CAGGAGGGGATGTCACAGAGTGG - Intronic
1094312773 12:29103813-29103835 AAGCAGGGGCCTGCACAGAGAGG - Intergenic
1099133707 12:78865663-78865685 CAGCTTGGGCTGTCAGAGAGAGG + Intronic
1102042760 12:109811091-109811113 ATGAAGGGGCAGTCACAGAGAGG - Intronic
1106461456 13:29973984-29974006 GAGCAGGGCCTGCCACAGAGTGG + Intergenic
1107355637 13:39563327-39563349 CAGCATGGACTGTCACAGAGGGG - Intronic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1114657016 14:24322435-24322457 AAGCATGGGCTTTCCCAGATAGG + Intronic
1117823218 14:59673188-59673210 AAGCAAGAGCTGTAACACAGTGG - Intronic
1119738309 14:76998122-76998144 AGGCAGGGGCTGTGGCAGAGAGG + Intergenic
1120246355 14:82011394-82011416 AAGCACTGGCTGTAACAGGGAGG - Intergenic
1122306156 14:100768131-100768153 AAGGACAGGCAGTCACACAGAGG - Intergenic
1125381755 15:39093117-39093139 AGGCACTGGCTGCAACAGAGAGG - Intergenic
1126552342 15:49946778-49946800 AAGCAGGGGCTGCCCCAGACTGG + Intronic
1127243135 15:57141083-57141105 AAGGACCGGCTGTCACAGTTTGG - Intronic
1131318692 15:91366024-91366046 AAGCTGGGGCTGTCACAAAGAGG - Intergenic
1140900427 16:79361835-79361857 AAGTCCAGGCTGTTACAGAGAGG + Intergenic
1141134185 16:81455157-81455179 GAGCCCGGGATGTCACAGATTGG + Intronic
1141606084 16:85154151-85154173 TGGCAGGGGCTCTCACAGAGAGG + Intergenic
1142278489 16:89135548-89135570 GACCACGTCCTGTCACAGAGAGG - Intronic
1146522555 17:33537396-33537418 AAGCACGTGCTGTGGCAGGGTGG - Intronic
1147796710 17:43048857-43048879 ATGCTGGGGCAGTCACAGAGAGG + Intronic
1151394483 17:73813188-73813210 AAGCAGGGGCACTCACAGAATGG + Intergenic
1151549709 17:74815061-74815083 GAGGACGGGGTGTCAGAGAGGGG + Intronic
1151598688 17:75093462-75093484 AAGTACCAGGTGTCACAGAGGGG - Intronic
1153820819 18:8829912-8829934 AAGCAGAGGCTGGCAAAGAGGGG + Intronic
1159202722 18:65207368-65207390 AGGCACGGGCTGGCATAAAGGGG + Intergenic
1161424172 19:4193343-4193365 AAGAAAGGGCTGTCAGAGAAGGG + Intronic
1161590560 19:5127403-5127425 AAGCCCGGGCAGACACACAGGGG - Intronic
1164754178 19:30677871-30677893 AAGGAAGGGCTGTTAGAGAGGGG + Intronic
1165654894 19:37524668-37524690 AAGCACAGCCTCTCACAGTGTGG + Intronic
1166226363 19:41398023-41398045 AAGGAAGGGCTGTCACAAAAGGG + Intronic
1166730797 19:45057966-45057988 AAGCACGGGGTGCCCCACAGAGG - Intronic
1168333242 19:55581367-55581389 ATGCAGGGGCTTTCACAAAGGGG - Intergenic
925417165 2:3678462-3678484 AAGCACGGGCTGTCACTCTAGGG - Exonic
927721929 2:25388609-25388631 AAGAAGAGGCTGGCACAGAGTGG + Intronic
932191174 2:69742310-69742332 AAGCCCGGGCGGCCACAGGGTGG + Intronic
938989327 2:136611805-136611827 AGGCCTGTGCTGTCACAGAGAGG + Intergenic
941260998 2:163296946-163296968 AAGCACGGGGAGCCACACAGGGG - Intergenic
942053622 2:172162969-172162991 CAGCACAGTCTGGCACAGAGAGG - Intergenic
946805754 2:223469818-223469840 AAGCACAGTCTGTAACAGAAAGG - Intergenic
947958673 2:234216322-234216344 AGGCAAGAGCTGTCACAGGGAGG - Intergenic
948614253 2:239188151-239188173 AAGCACAGGCACTCACAGAATGG + Intronic
1171179947 20:23084862-23084884 AAGCACAAGCTGTCGCAGAGGGG + Exonic
1174189779 20:48732003-48732025 CAGCAGGGACTGTCACAGGGTGG + Intronic
1180965627 22:19786741-19786763 CATCACAGGCTGTCACAGTGAGG - Exonic
1185186647 22:49404912-49404934 AAGCACAGCCCGTCAGAGAGCGG + Intergenic
952425139 3:33167901-33167923 TAGCACAGGTTTTCACAGAGAGG - Intronic
956501101 3:69885990-69886012 ATGCAGGAACTGTCACAGAGGGG + Intronic
957313430 3:78547466-78547488 AAGCACAGCCTGTCTAAGAGAGG - Intergenic
958634671 3:96728287-96728309 ATGCTTTGGCTGTCACAGAGTGG - Intergenic
961434639 3:126908383-126908405 AAGCAGGGCCTGGCACAGAGTGG + Intronic
961650999 3:128416574-128416596 AAGTTGGGGCTGTGACAGAGTGG + Intergenic
962808131 3:138941159-138941181 AAGTAGGGGCTGCCACACAGTGG + Intergenic
967130724 3:186468186-186468208 AAGGAAGGGCTGTAGCAGAGAGG - Intergenic
967752567 3:193131031-193131053 AAGCACAGGCTATGACAGAAGGG - Intergenic
968518060 4:1023143-1023165 AAGGAGCGGCTGTCACAGGGTGG + Intronic
969272398 4:6111690-6111712 AAGCACGGGCTGTCACAGAGGGG - Intronic
969417554 4:7070815-7070837 AAGCACAGGTCGTCCCAGAGGGG + Intergenic
977777904 4:100943832-100943854 AAGCAAATGCAGTCACAGAGAGG - Intergenic
979178218 4:117691907-117691929 AAGCACTAGCTGTGACAGAGAGG - Intergenic
981558774 4:146024385-146024407 AATCAGTGTCTGTCACAGAGGGG - Intergenic
985604557 5:851356-851378 AGGGACGTGGTGTCACAGAGCGG + Intronic
985724752 5:1510217-1510239 AAGCACGGGCTGTGGGGGAGAGG - Intronic
985912263 5:2893642-2893664 AAGCACAGGAGGACACAGAGAGG - Intergenic
990811591 5:59731182-59731204 AAGAACAGGTTGTCAGAGAGGGG + Intronic
991283604 5:64943874-64943896 AAACACTGGCTGGCAAAGAGTGG + Intronic
997771866 5:136562619-136562641 AAGCACATCCTGACACAGAGAGG + Intergenic
997817702 5:137034618-137034640 AAACTCGGGTTGTCTCAGAGAGG + Intronic
1008071783 6:47105624-47105646 AGGCATGGGCTGTCTCAAAGGGG - Intergenic
1012323640 6:97885418-97885440 ATCCAGCGGCTGTCACAGAGGGG + Intergenic
1017895423 6:158675243-158675265 TAGCACTGGATGTGACAGAGAGG + Intronic
1019490121 7:1308636-1308658 AGTCTCGGGCTGTCACAGAGGGG + Intergenic
1020215532 7:6187223-6187245 AAGCACAGGCCCTCACGGAGGGG + Intronic
1028657885 7:93231933-93231955 AAGAAAGGGCTGTCACTGAGGGG - Intergenic
1032520037 7:132536916-132536938 AAGCAGAGGCTGACACAGAGTGG - Intronic
1035682623 8:1499305-1499327 AGGCAGGGGCTCTCACAGGGCGG - Intergenic
1045663688 8:104464737-104464759 AAACATTGGCTGTCACTGAGAGG + Intronic
1048133953 8:131727728-131727750 AAGCAAGGGCTGGCCCACAGGGG - Intergenic
1049847773 8:144811641-144811663 AAGCAAAGGCTGAGACAGAGTGG + Intergenic
1049847818 8:144811990-144812012 AAGCAAAGGCTGAGACAGAGTGG + Intergenic
1051666467 9:19471259-19471281 AAGCACAGGCTGACAGAGAAGGG - Intergenic
1054965736 9:71025387-71025409 AAGCTCAGGCTGTCGCACAGTGG - Intronic
1056401069 9:86227729-86227751 CAGCAGAGGCTGTCACAGTGTGG - Intronic
1059010854 9:110457728-110457750 AAGCAGTGGCTGTCACATGGAGG - Intronic
1060496005 9:124118913-124118935 ATGCACGGGCTGTCTCAGCCAGG - Intergenic
1186378685 X:9034215-9034237 AACCACGGGCTGTCACTTAGGGG - Intronic
1187449365 X:19383050-19383072 AAGTACGGGGTGACACACAGCGG - Intronic
1188250917 X:27893139-27893161 AAGTACATGCTGTCATAGAGAGG + Intergenic
1188393972 X:29657066-29657088 CAGCCTGGGCTGTCATAGAGTGG - Intronic
1191823287 X:65336670-65336692 AAGCATTGTCTGTGACAGAGTGG + Intergenic
1199557251 X:149122809-149122831 AAGCAAGGGCAGCCCCAGAGAGG - Intergenic