ID: 969274466

View in Genome Browser
Species Human (GRCh38)
Location 4:6125404-6125426
Sequence CTGTAGCCATAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969274466_969274474 9 Left 969274466 4:6125404-6125426 CCCAGCTCCATCTATGGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 969274474 4:6125436-6125458 CTGTCAGGACTTCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 211
969274466_969274475 14 Left 969274466 4:6125404-6125426 CCCAGCTCCATCTATGGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 969274475 4:6125441-6125463 AGGACTTCCTGTTTTGGGTCAGG No data
969274466_969274473 8 Left 969274466 4:6125404-6125426 CCCAGCTCCATCTATGGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 969274473 4:6125435-6125457 ACTGTCAGGACTTCCTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 144
969274466_969274470 -6 Left 969274466 4:6125404-6125426 CCCAGCTCCATCTATGGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 969274470 4:6125421-6125443 CTACAGTGGCCCACACTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969274466 Original CRISPR CTGTAGCCATAGATGGAGCT GGG (reversed) Intronic
901758423 1:11455418-11455440 CTGAAGCCAGTGGTGGAGCTTGG + Intergenic
905328778 1:37177283-37177305 CTGTCGCCATAGTTTGGGCTTGG + Intergenic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
905847462 1:41244355-41244377 CTGTAGCCTTAGATAAGGCTTGG + Intergenic
905915231 1:41679764-41679786 TTCTAGCCCTAGATGGAACTGGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
907765250 1:57403410-57403432 CTCTAGCCATAGCTGCAACTAGG + Intronic
910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG + Intergenic
911304981 1:96222691-96222713 ATGTAGCCAGGGATGGAGGTAGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913478472 1:119261693-119261715 CTGTAACCATAGATGAGGATGGG - Intergenic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
918661120 1:187090271-187090293 CTGAAGCCATAGAGGGAGAGAGG + Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
920404251 1:205697215-205697237 CTGGAGCCAGAGATGTGGCTGGG - Intergenic
1064638966 10:17396399-17396421 GTGTAGCCATGGAGGGAACTGGG - Intronic
1070723021 10:78769702-78769724 CTGTAGCCGTAGGTGTAGGTGGG - Intergenic
1072077160 10:91988539-91988561 CTGTAGCCTTAGATAGCTCTTGG + Intronic
1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG + Intronic
1077597730 11:3548257-3548279 CAGTTGGGATAGATGGAGCTGGG - Intergenic
1078224646 11:9380920-9380942 CTGTATCCAAAAAAGGAGCTTGG - Intergenic
1079844304 11:25445626-25445648 CTGAAGCCTGAGAAGGAGCTCGG + Intergenic
1080290842 11:30669903-30669925 CTGTAGCAAAAGGTGGGGCTAGG - Intergenic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG + Intronic
1082073946 11:47961951-47961973 CTGTAGGCCTAGAAGGACCTGGG - Intergenic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1086957155 11:92945191-92945213 CTGTAGCCTTACATGGGCCTTGG - Intergenic
1089999060 11:122938115-122938137 CTGTTTTCATAGATTGAGCTGGG + Intronic
1091957322 12:4657597-4657619 CTGTTGTAATAAATGGAGCTTGG + Intronic
1092783780 12:12010045-12010067 CTTTGGCCATAGATGGACCTCGG + Intergenic
1093521569 12:20057360-20057382 CTGTTGCCATTGATGTTGCTAGG - Intergenic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG + Exonic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG + Intronic
1106755808 13:32821726-32821748 CTGGAGCCCTTGAGGGAGCTTGG + Intergenic
1108512581 13:51169665-51169687 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1108770950 13:53699947-53699969 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG + Intronic
1112924788 13:104660903-104660925 CTGTAGCCTGGGAAGGAGCTGGG + Intergenic
1113507212 13:110825619-110825641 CTGTGGCCATGGGTGGAGTTGGG - Intergenic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114344834 14:21783530-21783552 CTGTATCCAAACATGCAGCTGGG + Intergenic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117122215 14:52580397-52580419 CTGTAGCCCAAGCTGGAGTTCGG + Intronic
1117389325 14:55247999-55248021 CTGTGGCCATAGAGGGTGGTAGG + Intergenic
1117543314 14:56769679-56769701 CTGTAGCCAGAGATGAGGCCAGG - Intergenic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120025973 14:79584655-79584677 CTGTACCCATAGCAGTAGCTGGG - Intronic
1128946844 15:71829562-71829584 CTATAGCCCTAGAGGGTGCTAGG - Intronic
1129567597 15:76639972-76639994 CTGTAGCCATACATAGGCCTTGG + Intronic
1129683930 15:77674096-77674118 GGGTTGCCATAGATGGAGATGGG - Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133618400 16:7501871-7501893 CTGTAGCTATAGAGGTACCTGGG + Intronic
1138230628 16:55333146-55333168 CTTTAGCCATAGAAGGAGTTTGG - Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146943103 17:36857421-36857443 CTGTAAGAATAGATGGAGATGGG - Intergenic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG + Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG + Intronic
1168009439 19:53518896-53518918 CTGTGGCCATAAAAGGAGCAAGG - Intergenic
925303048 2:2830508-2830530 CTGCAGCCAGAAATGGTGCTGGG - Intergenic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
928188500 2:29138238-29138260 CTCTACTCATAGATGGTGCTGGG - Intronic
928906477 2:36373517-36373539 CTGTACCCAAAGATGGCACTTGG + Intronic
929204657 2:39277206-39277228 TGGTAACAATAGATGGAGCTGGG - Intronic
930887006 2:56337563-56337585 GTGGAGCCACAGATGGACCTGGG - Intronic
931710002 2:64980712-64980734 CTACAGCCATAGGTGGACCTAGG - Intergenic
931924798 2:67060334-67060356 CTATAGCCACTGATGGAGGTGGG - Intergenic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
937124586 2:119465372-119465394 CTGTAGGCATGGCTGGATCTAGG - Intronic
937683349 2:124668205-124668227 CTGTAGTCATACATTTAGCTAGG + Intronic
938170346 2:129070219-129070241 CTCTAGCCAAAGATGGAGTGAGG + Intergenic
941549894 2:166901956-166901978 TTTTAGCCAGAGATAGAGCTGGG + Intronic
941934138 2:170970218-170970240 CTGCAGCCATTGATGGAGGTGGG + Intergenic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG + Intergenic
1174427750 20:50444806-50444828 CTGTAGCCCAGGCTGGAGCTCGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1178056369 21:28803470-28803492 CTGTAGCAGTAGATTGAGATTGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
949110527 3:255012-255034 TTGTAGCTAGAGATGGAGATAGG - Intronic
949826845 3:8174565-8174587 ATGTAGCCAGAGTTGGAGGTGGG - Intergenic
951005348 3:17609557-17609579 AGGTAGCCAAAGATAGAGCTTGG - Intronic
954139033 3:48595524-48595546 CTGTGACCTTAGATGGAGTTAGG - Intergenic
954741357 3:52753361-52753383 CTGTGGCCAGAGATGCCGCTGGG + Intronic
957603348 3:82367325-82367347 CTGTAGCAATAGCTGAATCTTGG - Intergenic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
965517694 3:169639219-169639241 CTGAATCCATCGCTGGAGCTTGG - Intronic
967295356 3:187958897-187958919 CTGTGGCCTTTGATGGAGCCAGG + Intergenic
967959389 3:194908305-194908327 ATGTTACTATAGATGGAGCTAGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969466417 4:7359725-7359747 CTGTAGGCATTAATGTAGCTGGG + Intronic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
970886368 4:20991788-20991810 TTGTAGCCATGGCTGGGGCTTGG + Intronic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973947541 4:55974093-55974115 CTGTATCCTTAGCTGGTGCTGGG + Intronic
974110070 4:57514986-57515008 CTGCAGCAATACAGGGAGCTGGG - Intergenic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
975568173 4:75782836-75782858 CTGTAGCATTAGATGTAGATTGG - Exonic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
977155696 4:93570196-93570218 CAGTAGCCAGTGGTGGAGCTGGG + Intronic
977483683 4:97613953-97613975 TTGTAGCTGTAGATGAAGCTAGG - Intronic
977890667 4:102307931-102307953 CTTGAGCCATAGATGAAACTAGG - Intronic
982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG + Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983661783 4:170136368-170136390 CTGCAGCCATAGATTTAGCCAGG + Intergenic
984665777 4:182427584-182427606 CTATAGCCATAGATAAAGATGGG - Intronic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987675025 5:21063399-21063421 TTTTAGCCATAGCCGGAGCTGGG - Intergenic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
993599441 5:89902612-89902634 CTGTAGCCCAGGCTGGAGCTAGG + Intergenic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
999004663 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG + Intergenic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005592718 6:27345449-27345471 CAGTATCCATAGCTGGAGTTTGG + Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008422624 6:51319960-51319982 CTCTAGCCATATATGGCACTAGG + Intergenic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1010678069 6:78767717-78767739 CTTTAGCCATGGCGGGAGCTGGG - Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1017128019 6:151084082-151084104 ATGTAGCTATAGATGTAGCCAGG - Intronic
1025192034 7:56903087-56903109 CTGGGGCCATGGATGGTGCTAGG - Intergenic
1025679918 7:63673844-63673866 CTGGGGCCATGGATGGTGCTAGG + Intergenic
1029505411 7:100960883-100960905 CTGGAACCATAGAAGGTGCTGGG - Exonic
1030676944 7:112394161-112394183 CAGCAGCCTTGGATGGAGCTGGG - Intergenic
1031313208 7:120225667-120225689 TTGTAGACATAGTTGGACCTAGG - Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1033546387 7:142405200-142405222 CAGTAGGAATAGATGGAGTTGGG + Intergenic
1035385515 7:158469840-158469862 CTGTCGCCATAACAGGAGCTGGG + Intronic
1035385527 7:158469926-158469948 CTGTTGCCATAACAGGAGCTGGG + Intronic
1036586046 8:10124515-10124537 CTGGTGCCATAATTGGAGCTAGG + Intronic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG + Intergenic
1039622393 8:39010307-39010329 CTGTGGCAATAGAAAGAGCTTGG + Intronic
1041468368 8:58180651-58180673 CTGAGGCCACAGATAGAGCTAGG - Intronic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1050064250 9:1742198-1742220 CTGAAGCTAAAGATGCAGCTGGG - Intergenic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1052978695 9:34431111-34431133 CTGCAGCCATAGAGAGAGATTGG - Intronic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056946853 9:91005026-91005048 CTGCAGGGATAGGTGGAGCTCGG - Intergenic
1059762204 9:117349031-117349053 CTGGTGCCATAGAGAGAGCTAGG + Intronic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG + Intronic
1196195109 X:112831407-112831429 CTGTAGCCAGACATTGTGCTAGG + Intronic
1199243449 X:145575147-145575169 CTTGAGCCATAGCTAGAGCTGGG - Intergenic
1200254248 X:154571113-154571135 CTGTCACCATAAATGGTGCTTGG + Intergenic
1200263521 X:154633295-154633317 CTGTCACCATAAATGGTGCTTGG - Intergenic