ID: 969274470

View in Genome Browser
Species Human (GRCh38)
Location 4:6125421-6125443
Sequence CTACAGTGGCCCACACTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969274464_969274470 1 Left 969274464 4:6125397-6125419 CCACTCTCCCAGCTCCATCTATG 0: 1
1: 0
2: 4
3: 37
4: 475
Right 969274470 4:6125421-6125443 CTACAGTGGCCCACACTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
969274463_969274470 7 Left 969274463 4:6125391-6125413 CCAATGCCACTCTCCCAGCTCCA 0: 1
1: 0
2: 3
3: 58
4: 476
Right 969274470 4:6125421-6125443 CTACAGTGGCCCACACTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
969274467_969274470 -7 Left 969274467 4:6125405-6125427 CCAGCTCCATCTATGGCTACAGT 0: 1
1: 0
2: 2
3: 9
4: 171
Right 969274470 4:6125421-6125443 CTACAGTGGCCCACACTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
969274466_969274470 -6 Left 969274466 4:6125404-6125426 CCCAGCTCCATCTATGGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 969274470 4:6125421-6125443 CTACAGTGGCCCACACTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
969274462_969274470 8 Left 969274462 4:6125390-6125412 CCCAATGCCACTCTCCCAGCTCC 0: 1
1: 0
2: 1
3: 33
4: 352
Right 969274470 4:6125421-6125443 CTACAGTGGCCCACACTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
969274461_969274470 11 Left 969274461 4:6125387-6125409 CCACCCAATGCCACTCTCCCAGC 0: 1
1: 0
2: 3
3: 37
4: 681
Right 969274470 4:6125421-6125443 CTACAGTGGCCCACACTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
969274460_969274470 28 Left 969274460 4:6125370-6125392 CCAAGCTGGGACACAGGCCACCC 0: 1
1: 0
2: 7
3: 26
4: 251
Right 969274470 4:6125421-6125443 CTACAGTGGCCCACACTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969274470 Original CRISPR CTACAGTGGCCCACACTGTC AGG Intronic
900466086 1:2826144-2826166 CTGCAGTTTCCCACACTGCCAGG + Intergenic
901472318 1:9466176-9466198 CTACAGTGACCAACTCAGTCTGG + Intergenic
902620447 1:17647745-17647767 CTACAGTGGCCCCTTCTCTCAGG - Intronic
902746198 1:18476187-18476209 CTACATTTTCACACACTGTCAGG + Intergenic
903290282 1:22308596-22308618 CTACAGTAACCAACACTGTGTGG + Intergenic
903293633 1:22330151-22330173 CCACAGTGGCTCACCCTGTGGGG - Intergenic
909112873 1:71502607-71502629 TTTAAGTGGCCCACTCTGTCTGG + Intronic
911067369 1:93802537-93802559 CTTCAGTGGCCCATACTCCCTGG - Intronic
911174540 1:94806029-94806051 CTACAGTAGCCCTCAATGCCAGG + Intergenic
911285279 1:95983895-95983917 CTGCAGTGGCCAGCACTGTCTGG + Intergenic
911971998 1:104451128-104451150 CTACAGTACCCCACACAGTATGG - Intergenic
917455996 1:175186541-175186563 CTGCAGTCCTCCACACTGTCTGG - Intronic
917621790 1:176803597-176803619 CTACAGTTGCCCACACTGGTTGG + Intronic
919792519 1:201301164-201301186 CTACAAGGGTCCACACTATCAGG - Intronic
920672747 1:208016938-208016960 CTACAGTGCCACACACTGGAGGG - Intergenic
920870755 1:209792391-209792413 CTGCAATTGCCCACACTGGCTGG + Exonic
920916655 1:210263015-210263037 ACACAGTGACACACACTGTCAGG - Intergenic
1063372476 10:5530777-5530799 CTTCACTGGGGCACACTGTCGGG + Intergenic
1069220582 10:65878273-65878295 CTACACTGGGCCAGACTGACTGG + Intergenic
1070637395 10:78140239-78140261 CTATAGAGACCCACACTGGCTGG - Intergenic
1071824936 10:89316238-89316260 CTGCTTTGGCCCACACTGTGTGG - Intronic
1074260853 10:111851927-111851949 CTACAGTAGCCCTGACTGCCTGG - Intergenic
1076414892 10:130278785-130278807 CTGGAGCTGCCCACACTGTCAGG - Intergenic
1077910973 11:6571077-6571099 CTGCGGTGGCCCACGCTCTCTGG + Exonic
1081647331 11:44799094-44799116 CCACAGTGGCCCACTCTCTGGGG - Intronic
1081778919 11:45696449-45696471 CCACTGTGGCAGACACTGTCAGG + Intergenic
1084225474 11:67712228-67712250 CCTCAGTGTCCCACACTGTAAGG + Intergenic
1084263297 11:67992078-67992100 CCTCAGTGTCCCACACTGTAAGG + Intronic
1088226387 11:107624975-107624997 CCACAGGGCCCCACACTATCTGG + Intronic
1091628323 12:2139614-2139636 GTACAGAAGCCCACCCTGTCTGG - Intronic
1092124680 12:6066776-6066798 CTCCACAGGCCCTCACTGTCTGG + Intronic
1097802102 12:63925854-63925876 CCACAGTGGCCCAGTCTGTTAGG + Intronic
1098188798 12:67926250-67926272 CCACAGGGGCCCAGAATGTCAGG + Intergenic
1098236967 12:68426783-68426805 CCACAGTGGCTTACACTGGCTGG + Intergenic
1102507887 12:113395340-113395362 CTGCTGTGTCCCACACTGTAGGG - Intronic
1104719721 12:131038591-131038613 CTGGAGTGGCCCACAGTGTGGGG + Intronic
1106647092 13:31647819-31647841 ATACAGTAGCCCACCCTGTGGGG - Intergenic
1109404029 13:61874539-61874561 GTACAGTGGCGGAGACTGTCAGG - Intergenic
1113698192 13:112363980-112364002 CTGGACAGGCCCACACTGTCCGG - Intergenic
1116069936 14:40031198-40031220 TTACATTGGCCCACATTTTCAGG + Intergenic
1117456617 14:55904074-55904096 CTGCAGCTCCCCACACTGTCAGG - Intergenic
1118978144 14:70694928-70694950 CTACATTGGCCCAATCAGTCAGG - Intergenic
1120907377 14:89632427-89632449 CCCCAGGGGCCCACACTCTCAGG + Intronic
1122650547 14:103224015-103224037 CCACAGGGGCCCCCGCTGTCTGG + Intergenic
1123738976 15:23216503-23216525 CTACAGTGGACGATACTGTGAGG - Intergenic
1123888294 15:24749114-24749136 CCCCAGTGCCCCACACTGGCTGG - Intergenic
1124290196 15:28445473-28445495 CTACAGTGGACGATACTGTGAGG - Intergenic
1124293042 15:28472095-28472117 CTACAGTGGACGATACTGTGAGG + Intergenic
1125685627 15:41561614-41561636 CTACCGTGAGCCACACTGGCTGG - Exonic
1128220481 15:65964984-65965006 CTACAAGGGCCCACGCTGCCAGG - Exonic
1128705789 15:69836743-69836765 CCACAGTGCCCCCCAGTGTCAGG + Intergenic
1129530590 15:76261302-76261324 CTACCGTGAGCCACACTGGCTGG + Intronic
1129660488 15:77550370-77550392 CTACTGTGGCCCCCAAGGTCAGG + Intergenic
1131379927 15:91955077-91955099 CAACAGTGGCTCACAGTGTGAGG - Intronic
1137237255 16:46626124-46626146 CTACTGTGGCCCACACCGGCGGG + Intergenic
1142331059 16:89454212-89454234 CTACAGCTGCCCACACTTGCTGG - Intronic
1142378232 16:89717671-89717693 CTCCAGTGGCCCACCGTGTCTGG - Intronic
1147497060 17:40926821-40926843 CTACAAAGCCCTACACTGTCTGG + Intronic
1148270959 17:46261352-46261374 CCCCAGTGGCCCCCACTTTCTGG - Intergenic
1148846222 17:50531746-50531768 CTTCCTTGGCCCACACTTTCAGG + Intergenic
1151728732 17:75898766-75898788 CTCCAGAGGCCCACACTGTGGGG - Exonic
1157703961 18:49785602-49785624 CTACAGTATCCCACTGTGTCTGG - Intronic
1159022653 18:63155929-63155951 CACCAATGGCCCACACTGGCTGG - Intronic
1161059373 19:2207416-2207438 CCACAGTGGCCCACAGAGGCCGG - Intronic
1166177454 19:41084891-41084913 AAACAGTGGCACACCCTGTCAGG + Intergenic
1166830154 19:45634443-45634465 CTACCGTGGCCGAGACTGCCGGG - Exonic
929085604 2:38164640-38164662 CTCCAGTTGCCCACATTCTCAGG - Intergenic
929863603 2:45699564-45699586 CTACAGTGACCCACACAGCATGG - Intronic
934772866 2:96919150-96919172 CTACAGTGGCACACACACTAGGG + Intronic
936932239 2:117801923-117801945 CTCCAGTTGCCAACACTGTTGGG + Intergenic
937490845 2:122365703-122365725 CTCCACTGGCCTACACTGGCTGG - Intergenic
938981202 2:136528933-136528955 CTACAAAGGCCCACAGTCTCTGG + Intergenic
939732451 2:145801400-145801422 CTACAGTGTCCCACAATGATTGG + Intergenic
943014522 2:182495016-182495038 CTTCAGTGGTCCACTCTGTCGGG + Intronic
947182168 2:227421031-227421053 CTACAGGCGCCCACCATGTCTGG + Intergenic
948120300 2:235524415-235524437 CTAAACTTGCCCCCACTGTCAGG - Intronic
948243819 2:236461648-236461670 TGACAGTGGCCCACACTTTGAGG + Intronic
948877857 2:240839738-240839760 CTCCAGTGCCCCGCACTGTGAGG + Intergenic
1168758014 20:329203-329225 CAAGATTGGGCCACACTGTCTGG + Exonic
1170088669 20:12566269-12566291 CTACAGTGGCCCACGCAGGCAGG + Intergenic
1175978206 20:62724134-62724156 CCAAAGTGGCCCAAACTCTCAGG + Intronic
1179287749 21:39992606-39992628 CTTCAGTGGCCCCAACTCTCAGG - Intergenic
1181536474 22:23548912-23548934 CTGCGGTGGCCCACACTCTCAGG - Intergenic
1181757984 22:25038951-25038973 ATACTGTGGCCCACACAGTCTGG - Exonic
1182710322 22:32318623-32318645 CTACTGTGGTCCACACTAGCAGG + Intergenic
1184312487 22:43656610-43656632 TTACAATGGCCTACACTGTGCGG + Intronic
1184781187 22:46650466-46650488 CTACACAGGCCCAGACTGTGGGG - Intronic
1185419327 22:50726796-50726818 CTGCAGGGGCCCCCACTGGCAGG - Intergenic
951888639 3:27549250-27549272 CCACAGTGGCCCTAACTGACTGG - Intergenic
953313925 3:41908394-41908416 GTACAGTGGCCCATACGGTATGG - Intronic
960130742 3:114053601-114053623 ATCCAGTGTTCCACACTGTCAGG + Exonic
961750374 3:129090816-129090838 CTACTGTGGCCCACACCGGCGGG + Exonic
962258986 3:133891176-133891198 ATTCAGTGGCCCCCACTGCCTGG - Intronic
962849817 3:139299875-139299897 CCACAGTGGCCCAAGCTATCTGG - Intronic
962974766 3:140436579-140436601 CCACAGGGGCCCAGACTGGCTGG - Intronic
967318878 3:188176391-188176413 CTAGAGTCACACACACTGTCAGG + Intronic
968092322 3:195907179-195907201 CCAGAGTGGCTCTCACTGTCTGG - Intronic
969274470 4:6125421-6125443 CTACAGTGGCCCACACTGTCAGG + Intronic
970514372 4:16813625-16813647 CTACAGTCCCCCCAACTGTCTGG + Intronic
970918125 4:21359460-21359482 ATACAGTGGCCCATGCTATCAGG + Intronic
971590980 4:28468978-28469000 CTACAGTGTGCCACCATGTCTGG + Intergenic
971723703 4:30281014-30281036 GTACAGTGGCTCACAGTGTACGG + Intergenic
972163906 4:36259280-36259302 CTACAGAGGCCCATATTGTAGGG - Intergenic
976436061 4:85019503-85019525 CTTCAATGGCCCACATGGTCTGG + Intergenic
986184770 5:5424902-5424924 CTACAGGAGCCCACACAATCAGG - Intronic
986569863 5:9153624-9153646 CTGCAGTGGCACCCACTTTCCGG - Intronic
993220429 5:85088779-85088801 CTCCTGTGTCCCACAGTGTCAGG - Intergenic
995411019 5:111857215-111857237 CTGCTATGGCCCACACTGTGGGG - Intronic
1002542306 5:179914292-179914314 CAACATTGGCTCACACTGTCAGG - Intronic
1003979985 6:11380370-11380392 CTCCAGTTGCCCACAGTGGCGGG - Intronic
1006256476 6:32836644-32836666 TTACAGTCGCCCACAGTGTTAGG - Intronic
1013339862 6:109203161-109203183 CCACAGGGGCCCACACTGGAGGG + Intergenic
1014472252 6:121831015-121831037 CCCCAGTGGTCCACACTGCCAGG - Intergenic
1019798804 7:3072634-3072656 CTACAGGAGCCCCCACTGCCAGG - Intergenic
1021162672 7:17296129-17296151 CTACTGTAACCCACAGTGTCTGG + Intergenic
1021754504 7:23838388-23838410 CTACAGTAGCCAAAACTGTGTGG + Intergenic
1024295400 7:47837696-47837718 CCTCAGTAGCCCACAGTGTCTGG + Intronic
1024567202 7:50691128-50691150 CTACAGTTGCCCCCGCTGCCTGG - Intronic
1027521250 7:79211415-79211437 CTACAGTGCACCACTATGTCCGG + Intronic
1027541522 7:79472669-79472691 CTACAGTAGTCCACAGTGTCTGG + Intergenic
1029697464 7:102223440-102223462 GTGCAGTGGCTCACCCTGTCAGG + Intronic
1031243144 7:119271132-119271154 CTGCAGTGGCACACACAGACTGG + Intergenic
1031308528 7:120164332-120164354 CTACAGTGGCCCAACCCGTGTGG + Intergenic
1032457008 7:132080744-132080766 CTTCAGTGGCACACACAGCCAGG + Intergenic
1040550594 8:48434425-48434447 CAACAGTGGCCAGCACTGTTGGG - Intergenic
1049687785 8:143945872-143945894 CTGCAGTGGCCCACTCTGGGCGG + Intronic
1052850489 9:33375462-33375484 CTACAAAGGCCCACCCTATCAGG - Intergenic
1053184587 9:36004523-36004545 CCACAGTGGCTCACAATTTCTGG + Intergenic
1057333896 9:94141434-94141456 CGACATTGGCCCCCACTGTGGGG - Intergenic
1060643156 9:125256166-125256188 CTACACTGGCCCCCACTGGCAGG - Intergenic
1061245372 9:129398805-129398827 CTGCGGTGGCCCACACTCTCAGG + Intergenic
1062426594 9:136508869-136508891 CTACACTGGCCCCAACTGCCAGG - Exonic
1186487022 X:9941350-9941372 CCACTGTGGTCCATACTGTCTGG - Intronic
1192797516 X:74436423-74436445 CTTGAGTGAGCCACACTGTCTGG + Intronic
1193138049 X:77995045-77995067 CTACAGTGACCCATATTATCGGG + Intronic
1197713069 X:129686177-129686199 CTACATTGTCCCACCCTGTGGGG - Intergenic