ID: 969274473

View in Genome Browser
Species Human (GRCh38)
Location 4:6125435-6125457
Sequence ACTGTCAGGACTTCCTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969274462_969274473 22 Left 969274462 4:6125390-6125412 CCCAATGCCACTCTCCCAGCTCC 0: 1
1: 0
2: 1
3: 33
4: 352
Right 969274473 4:6125435-6125457 ACTGTCAGGACTTCCTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 144
969274467_969274473 7 Left 969274467 4:6125405-6125427 CCAGCTCCATCTATGGCTACAGT 0: 1
1: 0
2: 2
3: 9
4: 171
Right 969274473 4:6125435-6125457 ACTGTCAGGACTTCCTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 144
969274461_969274473 25 Left 969274461 4:6125387-6125409 CCACCCAATGCCACTCTCCCAGC 0: 1
1: 0
2: 3
3: 37
4: 681
Right 969274473 4:6125435-6125457 ACTGTCAGGACTTCCTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 144
969274464_969274473 15 Left 969274464 4:6125397-6125419 CCACTCTCCCAGCTCCATCTATG 0: 1
1: 0
2: 4
3: 37
4: 475
Right 969274473 4:6125435-6125457 ACTGTCAGGACTTCCTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 144
969274463_969274473 21 Left 969274463 4:6125391-6125413 CCAATGCCACTCTCCCAGCTCCA 0: 1
1: 0
2: 3
3: 58
4: 476
Right 969274473 4:6125435-6125457 ACTGTCAGGACTTCCTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 144
969274466_969274473 8 Left 969274466 4:6125404-6125426 CCCAGCTCCATCTATGGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 969274473 4:6125435-6125457 ACTGTCAGGACTTCCTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 144
969274469_969274473 1 Left 969274469 4:6125411-6125433 CCATCTATGGCTACAGTGGCCCA 0: 1
1: 0
2: 1
3: 6
4: 108
Right 969274473 4:6125435-6125457 ACTGTCAGGACTTCCTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969274473 Original CRISPR ACTGTCAGGACTTCCTGTTT TGG Intronic
901472248 1:9465833-9465855 ACCTTCAGGACATCCTGTATAGG - Intergenic
904504941 1:30944372-30944394 ACTGTAAGGACTTTGTGTTTTGG + Intronic
906319399 1:44807066-44807088 TCTGTCAGTCCTTCCTGGTTAGG - Intergenic
908649277 1:66314182-66314204 ACTGTCAGGATTACCTGTGTAGG - Intronic
909102296 1:71363994-71364016 ACTGACAGTAATTGCTGTTTAGG - Intergenic
910298161 1:85674049-85674071 AATGTCAGAAATTCCTGTTGAGG - Intronic
912360723 1:109092756-109092778 AGTGTCAGTACTGCCTGTTGAGG + Intronic
912811952 1:112801700-112801722 AGTGGGAGGACTTCCTGTCTGGG + Intergenic
913650079 1:120905380-120905402 CCTGTTAAGACTTCCTGATTGGG + Intergenic
914076597 1:144358120-144358142 CCTGTTAAGACTTCCTGATTGGG - Intergenic
914102581 1:144608377-144608399 CCTGTTAAGACTTCCTGATTGGG + Intergenic
914171045 1:145223705-145223727 CCTGTTAAGACTTCCTGATTGGG - Intergenic
914296316 1:146328830-146328852 CCTGTTAAGACTTCCTGATTGGG - Intergenic
914526158 1:148467673-148467695 CCTGTTAAGACTTCCTGATTGGG - Intergenic
914640246 1:149599451-149599473 CCTGTTAAGACTTCCTGATTGGG + Intergenic
917976796 1:180245073-180245095 GCTGGCAGGGCTTCCTGGTTGGG + Intronic
918245493 1:182656012-182656034 AATGTCAGGACTTACTGAATTGG + Intronic
1064561945 10:16602079-16602101 ACTGCCAGGAATGCCTGCTTAGG + Intronic
1064696387 10:17970158-17970180 TATGCCAGTACTTCCTGTTTTGG + Intronic
1065506863 10:26438270-26438292 ACTTTCTGGGCTTCCTCTTTTGG - Exonic
1070221335 10:74448730-74448752 ATTGTTAGGAATTCCTATTTAGG + Intronic
1076107519 10:127835165-127835187 ACTGTGATGCCTTCTTGTTTTGG - Intergenic
1078075010 11:8150804-8150826 ACAGTCAGGATTTCATGTTATGG - Intronic
1080393175 11:31866593-31866615 ACTGTCAGGGCTCTCTATTTTGG + Intronic
1081004419 11:37717124-37717146 ACTGCCAGGTCTTCCTTTTTTGG - Intergenic
1086148668 11:83583586-83583608 AATGTCAGGGCTTCCTTTTTGGG + Intronic
1087087132 11:94231237-94231259 ACTGTGAGGACCTGCTGTTCTGG - Intergenic
1089861355 11:121592633-121592655 ATTGTGTGGACTTCCTGTTTGGG + Intronic
1093896192 12:24577087-24577109 ACTGTCAGAACTTCCAGCCTTGG + Intergenic
1097599933 12:61678395-61678417 ACTCTCAGGATTTCCTGATCTGG + Intergenic
1097673465 12:62569735-62569757 ACTGTCCCTACTTCCAGTTTGGG - Intronic
1098488081 12:71044952-71044974 ACTCTCAGGGCTTCCTCTTGCGG - Intergenic
1100340728 12:93677346-93677368 GGTGTCAACACTTCCTGTTTAGG + Intergenic
1103690328 12:122767810-122767832 ACTTTCTGGAATTCCTGCTTGGG + Intronic
1103919243 12:124390877-124390899 CCTGGCTGGACTTCCTGTCTTGG - Intronic
1106956905 13:34949310-34949332 CCTGACAGGATCTCCTGTTTTGG + Intronic
1107096681 13:36545134-36545156 GCTGTCAGGTCTTCTGGTTTTGG - Intergenic
1108785144 13:53891418-53891440 GATGTCAGGACTTCCTGTTATGG - Intergenic
1112222758 13:97507795-97507817 ACTGACAGGACTTCCACATTGGG + Intergenic
1115472087 14:33778570-33778592 ACTGTAAGTACCTCCTGTGTGGG + Exonic
1121123891 14:91393500-91393522 AAGGTCTGGACTACCTGTTTTGG + Intronic
1122432818 14:101666666-101666688 ACTCTCAGCACATTCTGTTTGGG - Intergenic
1128781686 15:70362634-70362656 ACTGTATGGACATCCTGTTCCGG - Intergenic
1128890260 15:71325660-71325682 ACTGTCAGTACTGACTGCTTAGG + Intronic
1129051806 15:72787094-72787116 ACTCACAGGCCTTCCTGCTTGGG + Intergenic
1129367473 15:75065286-75065308 ACTGTCAAGACTTCTTGCCTGGG - Intronic
1136508312 16:30720729-30720751 ACTGTCCGGCCTTCTTGCTTAGG - Exonic
1137630689 16:49941706-49941728 CTTGTCAGGTCTTCCTGCTTGGG - Intergenic
1139240979 16:65392192-65392214 ACTGTCAGGACTCTCTCTGTAGG + Intergenic
1140773666 16:78229647-78229669 ACAGTCTGTACTTCTTGTTTTGG + Intronic
1141064203 16:80900806-80900828 TCTGACAGGACAGCCTGTTTGGG + Intergenic
1141295832 16:82768110-82768132 TCTCTCATGACTTCATGTTTAGG - Intronic
1143445778 17:7008385-7008407 ACTGTCAGGACTGCATAGTTGGG - Intronic
1144274022 17:13647555-13647577 ACTGGCTGCACCTCCTGTTTAGG + Intergenic
1148193974 17:45700091-45700113 ACTGTCAGGACCTCCTTTCTGGG + Intergenic
1149600053 17:57887357-57887379 ACTGTCAGAAGTTGGTGTTTAGG - Intronic
1152252675 17:79219991-79220013 ACAGCCAGCACTTCCTGTCTGGG + Intronic
1152888346 17:82865581-82865603 CCTGTCAGGCCTTCCCATTTCGG - Intronic
1153726107 18:7957017-7957039 AGTGTTAAGAATTCCTGTTTTGG + Intronic
1153869924 18:9308744-9308766 ACTGTCAGCATTTCGGGTTTTGG - Intergenic
1156291897 18:35754882-35754904 AATGTCAGAAGGTCCTGTTTTGG + Intergenic
1163685840 19:18711203-18711225 CCTGGGAGGACTTCTTGTTTGGG + Intronic
1163817256 19:19474402-19474424 ACTCCCAGCCCTTCCTGTTTTGG + Intronic
1165109907 19:33496276-33496298 ACTCTCAGGACATGCTGGTTAGG + Intronic
926609568 2:14932351-14932373 ACTGACAGCACCTACTGTTTTGG + Intergenic
930832636 2:55761567-55761589 ACTGCCATGCCCTCCTGTTTGGG - Intergenic
932372635 2:71204992-71205014 ACACTCAGGACTTACTTTTTGGG - Intronic
937201974 2:120209722-120209744 AGTGACAGGACTCCCTGGTTGGG - Intergenic
937310429 2:120899336-120899358 GCTTCCAGGACTTCCTTTTTTGG + Intronic
937329740 2:121019059-121019081 CCTTTCAGGCCGTCCTGTTTGGG + Intergenic
938402787 2:131006611-131006633 TCTGGAAGGATTTCCTGTTTGGG - Intronic
938615595 2:132994643-132994665 ACTGTCAGGTCTTTCTGTGATGG + Intronic
939230651 2:139421670-139421692 ACTTTCAGGACTTTCATTTTGGG - Intergenic
944730873 2:202516232-202516254 ATTGTAAGAACTTTCTGTTTTGG + Intronic
945516469 2:210768599-210768621 ACTCTCAGGGAATCCTGTTTCGG - Intergenic
947848140 2:233262299-233262321 GCTGGCTGGTCTTCCTGTTTCGG + Intronic
948932939 2:241143769-241143791 ATGGTCAGGACTCACTGTTTAGG - Intronic
1175066750 20:56295533-56295555 AATGTCTGGAGTTTCTGTTTGGG - Intergenic
1178336460 21:31748201-31748223 ACTGTCAGGCCATTTTGTTTAGG + Intergenic
1179100530 21:38352039-38352061 TCAGTGAGGACTTCCTTTTTAGG - Intergenic
1179495611 21:41769545-41769567 GCTGTCAGGACATCCAGTATAGG - Intergenic
1179532542 21:42029794-42029816 AATCTCAGGACTACCTGTCTGGG - Intergenic
1182623196 22:31629035-31629057 TTTGTCAGGACATGCTGTTTTGG + Intronic
1184038095 22:41928032-41928054 ACTCCCTGGACTTCCTGTTTGGG - Intergenic
1184678592 22:46056797-46056819 AATGTCAGCATTTGCTGTTTAGG + Intronic
949267101 3:2170502-2170524 AATGACAGGACTTCCCATTTAGG - Intronic
949626765 3:5875875-5875897 ACTGTCCTGTCTTCCTCTTTTGG + Intergenic
949854129 3:8444410-8444432 ACTGTTAGGAATTGCTGTCTGGG - Intergenic
951671319 3:25185657-25185679 ACTCACAGAAATTCCTGTTTTGG - Intronic
952267963 3:31804712-31804734 GCAGTCAGCACTTCGTGTTTTGG - Intronic
953448768 3:42989353-42989375 TCTGTCTGGACTTCCCTTTTAGG + Intronic
955863992 3:63362356-63362378 ACAGTTAAAACTTCCTGTTTGGG - Intronic
955949571 3:64228799-64228821 ACCTTCAGAACTTTCTGTTTAGG + Intronic
956704841 3:71990813-71990835 ACTGTCTGGAAGTCATGTTTGGG + Intergenic
956800667 3:72755128-72755150 ACAGGCAGGAGTTCCTGTTTGGG - Intronic
956851988 3:73237239-73237261 ATTGTCAGGACTTCCAGATATGG + Intergenic
959085144 3:101844632-101844654 ACTGTCTGGACTTGCTATTTCGG - Intronic
962756090 3:138466611-138466633 GCTGTCAGGACCTTCTGGTTGGG + Intronic
963296293 3:143550181-143550203 GCTTTCAGGAAATCCTGTTTAGG + Intronic
963693862 3:148540223-148540245 ACAGACAGGATTTCCTGTTTAGG + Intergenic
964387902 3:156168218-156168240 ACATTCAGGACTTACTTTTTTGG - Intronic
964650713 3:159008402-159008424 ATTGTCAGCACAGCCTGTTTTGG - Intronic
966776343 3:183545896-183545918 TCTGTGAGGACTTCCTGCTCTGG + Intronic
968798105 4:2722641-2722663 ACAGTCAGCCCTTCCAGTTTAGG + Intronic
969274473 4:6125435-6125457 ACTGTCAGGACTTCCTGTTTTGG + Intronic
969279891 4:6162655-6162677 ACTGTCACGACAACCTGTTAAGG + Intronic
970062196 4:12047317-12047339 ACAATCAGGACTTTCTCTTTTGG + Intergenic
971722249 4:30260336-30260358 ACTTCCAGGACTTCCAGTTGTGG - Intergenic
973171117 4:47145236-47145258 AGAGTCTGGACTTCCTTTTTTGG + Intronic
974043612 4:56878852-56878874 AATGTCAGTATTTGCTGTTTTGG - Intergenic
974630872 4:64486494-64486516 ACTGACAGTATTTCCTCTTTGGG + Intergenic
977872246 4:102105928-102105950 ACTGCCAGGATATCCTCTTTGGG + Intergenic
978267155 4:106840023-106840045 AATGTCAGCCTTTCCTGTTTTGG - Intergenic
979956024 4:126955295-126955317 CCAGTCAGGAATTCTTGTTTTGG + Intergenic
980648761 4:135682214-135682236 CCTATCAGGACTTCCTTCTTAGG - Intergenic
981746662 4:148058769-148058791 ACTGTCATAATTTCATGTTTTGG + Intronic
982982371 4:162155709-162155731 ACTTTCAAGAATCCCTGTTTAGG - Intronic
989981191 5:50647906-50647928 CCTGTTAAGACTTCCTGATTAGG + Intergenic
990428799 5:55714340-55714362 ACTGTCAGGAGCACCTTTTTTGG + Intronic
991099447 5:62776486-62776508 GCAGTCAGGACGTCCTGTCTCGG + Intergenic
993396128 5:87391320-87391342 ACTGTAACTACTTCCTGATTAGG + Intronic
997523124 5:134535913-134535935 ACAGTAAGGCCTTCCAGTTTGGG + Exonic
999728555 5:154457747-154457769 ACTGTGAGGGCATCCTATTTTGG + Exonic
999840861 5:155425100-155425122 TCTGTAATGGCTTCCTGTTTAGG - Intergenic
1003293737 6:4805597-4805619 GCTCTCAGGACTTCGGGTTTGGG - Intronic
1005724798 6:28638118-28638140 ACAGTCTGGATTTCCAGTTTAGG - Intergenic
1011005426 6:82639136-82639158 GCTGTAAGGACGTTCTGTTTTGG - Intergenic
1012703326 6:102491569-102491591 AATGTTAGGACTTTCAGTTTCGG - Intergenic
1016701431 6:147058579-147058601 CCTATCAGGACTTTCTATTTTGG - Intergenic
1017919939 6:158862833-158862855 ACTGTCAGGTATTGCTATTTTGG + Intergenic
1021251391 7:18330735-18330757 ACTGTCAGCAGTTTCTATTTTGG - Intronic
1023637064 7:42222863-42222885 ATTATCAGAAGTTCCTGTTTTGG - Intronic
1030566981 7:111169762-111169784 ACAATTAGGACTTCATGTTTTGG + Intronic
1032681165 7:134185010-134185032 TCTGACAGGTCTTCCTCTTTTGG + Intronic
1034049487 7:147967155-147967177 AATGTAAGGAACTCCTGTTTAGG + Intronic
1038241295 8:25809923-25809945 ACTTTCAACACTTTCTGTTTTGG + Intergenic
1038340634 8:26682516-26682538 ACTGTCAGGCTTTCTGGTTTAGG - Intergenic
1038751710 8:30302091-30302113 TCTGTAAAGACTTCCTGGTTAGG - Intergenic
1039373609 8:37011743-37011765 GCAGTCAAGACCTCCTGTTTGGG + Intergenic
1040589958 8:48782497-48782519 ACTGTAAGGACTGCCTCTGTGGG + Intergenic
1043564102 8:81528640-81528662 ACAGACAGGAAATCCTGTTTTGG + Intronic
1045558771 8:103240502-103240524 ACTGACAGAACTTGCTGTTTTGG + Intergenic
1047934951 8:129767348-129767370 ACTGTTTGGACTTCCTGGTCAGG - Intronic
1050107810 9:2183711-2183733 GCTTTCAAGACCTCCTGTTTTGG - Intronic
1055388716 9:75795010-75795032 ACTGTCATGGCTTCCTATCTTGG + Intergenic
1055420355 9:76134143-76134165 ATTGTCAGGACTTCCCGTGCGGG + Exonic
1059625124 9:116055499-116055521 AATGACAGGATTTCCTTTTTGGG + Intergenic
1061422835 9:130481362-130481384 GGGGTCAGGGCTTCCTGTTTCGG + Intronic
1187272582 X:17792455-17792477 ACTGTCAGGCCTTTCTGGTTTGG - Intergenic
1187310376 X:18135867-18135889 AGTGTTAGGACTGCCTGCTTGGG - Intergenic
1187714216 X:22086138-22086160 ACTGCCAGGATATCCTCTTTAGG - Intronic
1188762477 X:34049751-34049773 ACTGTATGGACTCCATGTTTGGG - Intergenic
1188986255 X:36771019-36771041 TCTGTCAGTATTTCCTGTTGGGG + Intergenic
1189589620 X:42497196-42497218 ACTCTCAGAAGTTCCTGGTTTGG + Intergenic
1196100926 X:111846434-111846456 ACTGTCAAGACCTACTTTTTGGG - Intronic
1197324572 X:125076372-125076394 AATATCATGGCTTCCTGTTTTGG + Intergenic
1198318643 X:135496236-135496258 ACTATGAGGACTTCCACTTTGGG + Intergenic
1202079809 Y:21072591-21072613 AGAGTCAAGACTTCCTGTATTGG - Intergenic