ID: 969274474

View in Genome Browser
Species Human (GRCh38)
Location 4:6125436-6125458
Sequence CTGTCAGGACTTCCTGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 211}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969274469_969274474 2 Left 969274469 4:6125411-6125433 CCATCTATGGCTACAGTGGCCCA 0: 1
1: 0
2: 1
3: 6
4: 108
Right 969274474 4:6125436-6125458 CTGTCAGGACTTCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 211
969274464_969274474 16 Left 969274464 4:6125397-6125419 CCACTCTCCCAGCTCCATCTATG 0: 1
1: 0
2: 4
3: 37
4: 475
Right 969274474 4:6125436-6125458 CTGTCAGGACTTCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 211
969274461_969274474 26 Left 969274461 4:6125387-6125409 CCACCCAATGCCACTCTCCCAGC 0: 1
1: 0
2: 3
3: 37
4: 681
Right 969274474 4:6125436-6125458 CTGTCAGGACTTCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 211
969274462_969274474 23 Left 969274462 4:6125390-6125412 CCCAATGCCACTCTCCCAGCTCC 0: 1
1: 0
2: 1
3: 33
4: 352
Right 969274474 4:6125436-6125458 CTGTCAGGACTTCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 211
969274463_969274474 22 Left 969274463 4:6125391-6125413 CCAATGCCACTCTCCCAGCTCCA 0: 1
1: 0
2: 3
3: 58
4: 476
Right 969274474 4:6125436-6125458 CTGTCAGGACTTCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 211
969274466_969274474 9 Left 969274466 4:6125404-6125426 CCCAGCTCCATCTATGGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 969274474 4:6125436-6125458 CTGTCAGGACTTCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 211
969274467_969274474 8 Left 969274467 4:6125405-6125427 CCAGCTCCATCTATGGCTACAGT 0: 1
1: 0
2: 2
3: 9
4: 171
Right 969274474 4:6125436-6125458 CTGTCAGGACTTCCTGTTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969274474 Original CRISPR CTGTCAGGACTTCCTGTTTT GGG Intronic
901790535 1:11651406-11651428 TTGTCAGGAACTCATGTTTTGGG + Intronic
906319398 1:44807065-44807087 CTGTCAGTCCTTCCTGGTTAGGG - Intergenic
907709041 1:56860844-56860866 CTTTGAGGAATTCCAGTTTTTGG + Intronic
909043725 1:70685435-70685457 CTGTCAGCACTTATTGTATTGGG + Intergenic
912734111 1:112134841-112134863 TTGGCAGCACTTCCTGTATTAGG + Intergenic
912870547 1:113300762-113300784 TTGTCAGGACTTTATGTTTCAGG + Intergenic
913030419 1:114897202-114897224 CTGACAGGAGGTGCTGTTTTGGG + Intronic
913472556 1:119203999-119204021 CTGTCATCACGTCCTTTTTTGGG - Intergenic
915290673 1:154881066-154881088 CTCCCAGGAGTTCCTGTGTTGGG - Intergenic
916732071 1:167575253-167575275 CTGACAGGATATGCTGTTTTGGG - Intergenic
917527717 1:175803758-175803780 ATGTCAGGTTTTCCTGTTTGTGG + Intergenic
918245494 1:182656013-182656035 ATGTCAGGACTTACTGAATTGGG + Intronic
918249571 1:182689921-182689943 CTGTCTGGAGATCCTGTTCTTGG + Intergenic
918418268 1:184335114-184335136 CAGGCAGGACTGCTTGTTTTTGG - Intergenic
918654644 1:187009416-187009438 CTGGTAGCACTCCCTGTTTTGGG - Intergenic
920115131 1:203615418-203615440 CTGACCGGACCACCTGTTTTGGG - Intergenic
920134678 1:203760039-203760061 CAGTAAGGACTGTCTGTTTTAGG + Intergenic
921233843 1:213102899-213102921 CTGTTAAGATTTCCTGTTATAGG + Intronic
922437392 1:225619973-225619995 CTGTAAGAAATTACTGTTTTTGG - Intronic
923184289 1:231555224-231555246 ATGTCAGAATTTCCTGTTTAAGG - Intronic
923402948 1:233632854-233632876 CTCTCAGGACTTAGTTTTTTGGG + Intronic
923415678 1:233757494-233757516 CTGTCAGGGCTTACTCTTATGGG + Intergenic
923482192 1:234396152-234396174 CTGTCTGTTCTGCCTGTTTTTGG - Intronic
1063705724 10:8428766-8428788 ATCCCAGGACTTCCTGTATTTGG + Intergenic
1063771310 10:9205258-9205280 GTATCTGGAATTCCTGTTTTGGG + Intergenic
1063810112 10:9695382-9695404 CTGTCAGCACCTCCTGTGTCTGG - Intergenic
1064339545 10:14473998-14474020 CTTTCAGGGGTTCCTGGTTTTGG - Intergenic
1065175799 10:23073711-23073733 TTGTCAGGCATTCCTGTGTTAGG + Intergenic
1065212291 10:23415850-23415872 TTGTCAGTACTACTTGTTTTTGG - Intergenic
1065506862 10:26438269-26438291 CTTTCTGGGCTTCCTCTTTTGGG - Exonic
1066020970 10:31301449-31301471 ATGACAGGATTTCCTGCTTTAGG + Intergenic
1066486376 10:35849214-35849236 CTGTCAGGATTTTCTGGTTGTGG + Intergenic
1068208293 10:53886532-53886554 CTATCATGACTTCATGTTTTTGG + Intronic
1068303689 10:55177274-55177296 CTGTCTGAGCTTCCTTTTTTAGG - Intronic
1070061033 10:72982708-72982730 CTGTCAATACTTACTTTTTTTGG + Intergenic
1072156818 10:92731169-92731191 CTCTCAGCACTTCTTTTTTTGGG + Intergenic
1072205420 10:93199967-93199989 CTTTCAGGACCTTTTGTTTTAGG - Intergenic
1073908158 10:108308496-108308518 TTATCTGGACTTCCTGCTTTAGG - Intergenic
1075431466 10:122385676-122385698 CTGTCAGTAGTTCCTTTTTACGG + Intronic
1076006850 10:126954754-126954776 GTGTCAGAATTTCCTTTTTTAGG + Intronic
1076107518 10:127835164-127835186 CTGTGATGCCTTCTTGTTTTGGG - Intergenic
1077194645 11:1273196-1273218 CAGTCAGGATTTCTTTTTTTAGG - Intergenic
1078397050 11:10990449-10990471 CTCTCAGGCATTCCTGCTTTAGG + Intergenic
1080885104 11:36360475-36360497 TTGTCATGGTTTCCTGTTTTGGG - Intronic
1081004418 11:37717123-37717145 CTGCCAGGTCTTCCTTTTTTGGG - Intergenic
1085040700 11:73324693-73324715 CTTTCAGGACTGCCTGAGTTGGG + Intronic
1085897055 11:80652761-80652783 CTGTCAGGCATTCCTTTTTATGG + Intergenic
1085946395 11:81278127-81278149 CTGACAAGAGGTCCTGTTTTGGG - Intergenic
1087063676 11:94008175-94008197 CTGTCAGAGCTTCCTAATTTTGG - Intergenic
1089580159 11:119476688-119476710 CTGTGGGGACTTCCTGTTTCAGG + Intergenic
1089667189 11:120027863-120027885 TTGTCAGGACCTCCTGTCTCTGG - Intergenic
1090480336 11:127062098-127062120 CTTGCTGCACTTCCTGTTTTTGG + Intergenic
1097599934 12:61678396-61678418 CTCTCAGGATTTCCTGATCTGGG + Intergenic
1099143187 12:79006189-79006211 CTTTCAGGATTTCCTGTCTCTGG + Intronic
1100340729 12:93677347-93677369 GTGTCAACACTTCCTGTTTAGGG + Intergenic
1101508510 12:105371178-105371200 ATGTCAGAATTTCCTTTTTTAGG + Exonic
1102245857 12:111355336-111355358 CTGGCTAAACTTCCTGTTTTTGG - Intergenic
1102595821 12:113991927-113991949 CTGTAAGCACTTGCTGCTTTAGG + Intergenic
1102699041 12:114823329-114823351 CTGTGAGGAGTTACTGTTTAAGG - Intergenic
1104099971 12:125598487-125598509 CTGTAAAGAATTCATGTTTTAGG - Intronic
1109239517 13:59868019-59868041 CTGCCATGACTTCTTGTTCTTGG - Intronic
1110347344 13:74463997-74464019 CTGTCAGTTTCTCCTGTTTTAGG + Intergenic
1111342686 13:86908873-86908895 TTGTCATGAATTCCTGTATTAGG - Intergenic
1114080031 14:19195771-19195793 CAGTCAGGCCTTCCTTTTCTAGG - Intergenic
1115946428 14:38666427-38666449 TTCTCTGGACTTCCTGTTGTGGG - Intergenic
1116151246 14:41145166-41145188 ATGTCAGGACTACCTGTCTATGG - Intergenic
1116741498 14:48760892-48760914 CATTCATGACTTCCTGTCTTGGG + Intergenic
1118296991 14:64579427-64579449 CTGTAAAAGCTTCCTGTTTTTGG - Intronic
1119672197 14:76528261-76528283 CTCTCAGTCCTTCCTGGTTTTGG - Intergenic
1122017302 14:98807335-98807357 CTGACATTCCTTCCTGTTTTGGG + Intergenic
1125514034 15:40308011-40308033 CTCTCAGCACTTCCTGCTCTGGG + Intergenic
1126541615 15:49830494-49830516 CTCACAAGACTTCCTGTGTTAGG + Intergenic
1128132345 15:65237270-65237292 ATGGCAGGACTTCCTGTGTCTGG - Intronic
1128391982 15:67188500-67188522 CTCTCAGGCCATCCTGCTTTGGG + Intronic
1128447513 15:67777006-67777028 CAGTCATGAATTCCTGTTTTTGG - Intronic
1131714008 15:95088747-95088769 CTGCCAGTATTTCCTGTATTAGG + Intergenic
1134160022 16:11880161-11880183 GTGTCAGAACTTCCTTTTTAAGG + Intronic
1135485608 16:22862190-22862212 CAATTAGGCCTTCCTGTTTTAGG + Intronic
1137759212 16:50927104-50927126 CTGTCAGGTCCTCCTGTCTGTGG + Intergenic
1140196728 16:72861368-72861390 CTGGCCGGCCATCCTGTTTTGGG + Intronic
1140773667 16:78229648-78229670 CAGTCTGTACTTCTTGTTTTGGG + Intronic
1143415392 17:6744613-6744635 CTTTCAGGATTTTCAGTTTTGGG - Intergenic
1145190556 17:20840387-20840409 CAGGAAGGAATTCCTGTTTTTGG - Intronic
1148504018 17:48113320-48113342 CTGCCAAGACTTCCTGTGTGCGG + Exonic
1153023220 18:650778-650800 GTCTCAGAACTTCCTTTTTTAGG + Intronic
1153726108 18:7957018-7957040 GTGTTAAGAATTCCTGTTTTGGG + Intronic
1156291898 18:35754883-35754905 ATGTCAGAAGGTCCTGTTTTGGG + Intergenic
1157443655 18:47729128-47729150 TTCTCAGGAATTCCAGTTTTAGG - Intergenic
1157874146 18:51255997-51256019 ATCTCAGGACTTCTTGTTATGGG + Intergenic
1159753171 18:72328151-72328173 CTGTCAGTAGTTACTTTTTTGGG - Intergenic
1160783402 19:888680-888702 TTGTCTGTATTTCCTGTTTTTGG - Intronic
1161237082 19:3203632-3203654 TGGTCAGGATTTCCTGCTTTGGG + Intronic
1161261724 19:3341531-3341553 CTGGTAGCACTTCCTGTGTTTGG - Intergenic
1161490726 19:4559741-4559763 ATGCGAGGTCTTCCTGTTTTTGG - Exonic
1162669537 19:12243491-12243513 ATGTCAGGATTTCCTTTTTACGG + Intronic
1167592996 19:50414541-50414563 CTGTCTGGATCTCATGTTTTAGG + Intronic
926609569 2:14932352-14932374 CTGACAGCACCTACTGTTTTGGG + Intergenic
928502212 2:31908526-31908548 CTGTCCATACTTCCAGTTTTTGG - Intronic
929609173 2:43257223-43257245 TTGTCCAGACTACCTGTTTTGGG + Intronic
931028603 2:58144066-58144088 ATGTCAGGATTTCCTTTTTATGG - Intronic
933895136 2:86804246-86804268 GTGTCAGAACTTCCTTTTTAAGG - Intronic
933950749 2:87327121-87327143 CAGTCAACACTTCCTTTTTTTGG + Intergenic
934061209 2:88295901-88295923 CTTCCAGGACTCCCTGCTTTGGG - Intergenic
936329029 2:111531457-111531479 CAGTCAACACTTCCTTTTTTTGG - Intergenic
939442304 2:142264708-142264730 CTGTCAGGAATTACAGTGTTTGG - Intergenic
941149868 2:161901068-161901090 CTGTCAGAAATTGCTATTTTGGG + Intronic
942574854 2:177352569-177352591 TTCCCAGGCCTTCCTGTTTTGGG + Intronic
944730874 2:202516233-202516255 TTGTAAGAACTTTCTGTTTTGGG + Intronic
945509707 2:210685883-210685905 CTATTAGGACTTCCTGTTTTAGG - Intergenic
947837712 2:233187717-233187739 CTGTCAGAAGTCCCTGTTCTGGG + Intronic
948359779 2:237412101-237412123 CTGTCTGGACTTCTTTGTTTAGG - Intronic
1171148898 20:22809849-22809871 CTGTCAGGACTGCCTGTCACAGG - Intergenic
1172756803 20:37290908-37290930 GTGTCAGAAGTTACTGTTTTAGG - Intronic
1178886359 21:36488118-36488140 GTGTCAGAACTTCCTTTTTCTGG - Intronic
1179477337 21:41655888-41655910 ATGTCAGAACTTCCTTTTTAAGG + Intergenic
1180500740 22:15926929-15926951 CAGTCAGGCCTTCCTTTTCTAGG + Intergenic
1181977734 22:26743011-26743033 CTGTAAGGTCTTCCTGATCTGGG - Intergenic
1182570102 22:31230576-31230598 CTTTCAGGACTTCCTTTCTCAGG + Intronic
1182623197 22:31629036-31629058 TTGTCAGGACATGCTGTTTTGGG + Intronic
1183786818 22:40034061-40034083 CTGTCAGCACTGGCTGCTTTTGG - Exonic
1185156739 22:49197599-49197621 CTGCCAGGACTCCCTGTGATTGG + Intergenic
949626766 3:5875876-5875898 CTGTCCTGTCTTCCTCTTTTGGG + Intergenic
952070337 3:29626786-29626808 ATATCAGGACTTCTTGTTTCAGG - Intronic
952411370 3:33052822-33052844 TTGTGGGGACTTCTTGTTTTAGG + Intronic
952520453 3:34151771-34151793 CTTTCAGGATCTCCTGTTTGAGG + Intergenic
953448769 3:42989354-42989376 CTGTCTGGACTTCCCTTTTAGGG + Intronic
953692511 3:45131911-45131933 CTGACAGGACTGCATTTTTTTGG + Intronic
955143920 3:56297375-56297397 CTTTCAAGACTTTCTGTTTCTGG - Intronic
956560584 3:70570069-70570091 TTGTCAGGAGTTTCTGCTTTTGG - Intergenic
960748806 3:120922478-120922500 TAGTCAGGACTTTCTGTATTAGG + Intronic
961098282 3:124176167-124176189 CTGAAAAGACTTGCTGTTTTAGG - Intronic
961098443 3:124177388-124177410 CTGAAAAGACTTGCTGTTTTAGG - Intronic
964244821 3:154639349-154639371 TTGCCAGCACTTGCTGTTTTTGG - Intergenic
964387901 3:156168217-156168239 CATTCAGGACTTACTTTTTTGGG - Intronic
965759017 3:172054826-172054848 CTTTCAGGACTTGCTGTGGTAGG + Intronic
966397794 3:179519959-179519981 CTGTAAGGCTTTCCGGTTTTTGG - Intergenic
969274474 4:6125436-6125458 CTGTCAGGACTTCCTGTTTTGGG + Intronic
970028684 4:11653181-11653203 CTGTCATAACTGCCTGTTTCTGG - Intergenic
970062197 4:12047318-12047340 CAATCAGGACTTTCTCTTTTGGG + Intergenic
971499480 4:27302723-27302745 GTGTCAGGGCTTCTTGTTCTAGG + Intergenic
972461372 4:39306623-39306645 CTGTCAGGCCCTCCTGGTGTTGG - Exonic
973662197 4:53119637-53119659 CTGTGAGGACTGCCAGTGTTTGG + Intronic
974434808 4:61843309-61843331 GTGTTAGAACCTCCTGTTTTTGG + Intronic
976115528 4:81722254-81722276 CTGTCAGGATAGCCTGTCTTGGG + Intronic
977070146 4:92375032-92375054 CTGTCATGGCTGCCTATTTTAGG - Intronic
977328953 4:95612291-95612313 CTGCCAGGACTTCTTGTCTGTGG - Intergenic
977396147 4:96473076-96473098 ATGTCAGGTTTTCTTGTTTTTGG + Intergenic
977781653 4:100987560-100987582 CTCTCAGAACTCCATGTTTTAGG + Intergenic
977928233 4:102725370-102725392 CTGTCAGCACTTCCTTGTTTTGG - Intronic
980492044 4:133540837-133540859 CTGAGTGGACTTCCTCTTTTAGG - Intergenic
980982539 4:139666857-139666879 CTGTGAGGCCTTCCTGCTTCTGG - Intronic
981746663 4:148058770-148058792 CTGTCATAATTTCATGTTTTGGG + Intronic
982253988 4:153434742-153434764 GTGTCAGAATTTCCTTTTTTAGG + Intergenic
982696566 4:158608958-158608980 GTGTCAGAATTTCCTTTTTTAGG + Intronic
984352625 4:178614691-178614713 CTGGCAGGACATCCTGTTCTAGG + Intergenic
985061033 4:186079636-186079658 CTGACAGGACTGTCTCTTTTTGG + Intronic
986052000 5:4098831-4098853 CTGGCAGGACTTCCTGCCTCCGG + Intergenic
992138491 5:73771602-73771624 CTGACAGGTTTTCCTGTGTTGGG + Intronic
992479738 5:77138627-77138649 CTGAGAGGAATTCATGTTTTAGG + Intergenic
993186436 5:84627848-84627870 CTGGCAAGATATCCTGTTTTGGG + Intergenic
993267685 5:85747541-85747563 TTGTCCCAACTTCCTGTTTTGGG + Intergenic
995610777 5:113908420-113908442 GTGTCCAAACTTCCTGTTTTTGG - Intergenic
997914282 5:137908885-137908907 CAGTTAGGATTTCTTGTTTTTGG + Exonic
999840860 5:155425099-155425121 CTGTAATGGCTTCCTGTTTAGGG - Intergenic
1000007976 5:157204971-157204993 CAGTCTTTACTTCCTGTTTTTGG - Intronic
1000580707 5:163032466-163032488 CTGTAAGAAATTCCTGTTTATGG - Intergenic
1000896412 5:166860692-166860714 CTGTCAGAATTTCCTGATTTTGG + Intergenic
1001042944 5:168349782-168349804 CTCACAGCCCTTCCTGTTTTTGG + Intronic
1001315646 5:170639459-170639481 CTCTGAGGACTTCCTGGGTTGGG + Intronic
1001710176 5:173772131-173772153 GTCTCAGGGCTTCCTGATTTTGG - Intergenic
1002939171 6:1700807-1700829 GTGTCAGGCATTCCTGTTCTTGG - Intronic
1004527303 6:16421188-16421210 GTTTCTGGCCTTCCTGTTTTAGG + Intronic
1005075915 6:21907338-21907360 ATGTCAGTATTTGCTGTTTTAGG + Intergenic
1006629314 6:35419960-35419982 CTGTCAGTACCCCCTGTTCTAGG + Intronic
1007914205 6:45545905-45545927 GTGAAAGGACTTCATGTTTTAGG + Intronic
1008328086 6:50209671-50209693 TTGTTAAGACTTCCTATTTTTGG - Intergenic
1009489244 6:64267307-64267329 ATGTCAGGACTTGGTGTTTGAGG - Intronic
1009791029 6:68401440-68401462 CTCTCAGAAATGCCTGTTTTAGG - Intergenic
1009907815 6:69890940-69890962 CTGACAGGGGTTGCTGTTTTGGG + Intronic
1014585327 6:123191061-123191083 CTGTGAGAAATTCCTGTTTGTGG + Intergenic
1014997547 6:128168899-128168921 ATGTCAGGATTGCCTTTTTTAGG - Intronic
1015008784 6:128317517-128317539 CTGTCAGCACATACTGTTTGTGG - Intronic
1016289680 6:142515243-142515265 CTGTCTGGACTTCTTTTTGTTGG + Intergenic
1018993913 6:168695976-168695998 CTGGCAGGAATTCCTATTTCAGG + Intergenic
1020442908 7:8237758-8237780 ATGACAGGACTTCCTTTTTAAGG + Intronic
1021251390 7:18330734-18330756 CTGTCAGCAGTTTCTATTTTGGG - Intronic
1021406922 7:20280906-20280928 CTGTCAGGTCTTATTATTTTAGG + Intergenic
1022678939 7:32526266-32526288 CTGACAGGAGGTGCTGTTTTGGG + Intronic
1024227096 7:47334078-47334100 CTGTGCGGACTTCCTGGATTTGG - Intronic
1024971480 7:55075370-55075392 ATGACAGAATTTCCTGTTTTAGG + Intronic
1025970756 7:66322556-66322578 GTGACAGGACTTCCTTTTTAAGG + Intronic
1026539947 7:71271176-71271198 CTTTCAATACTTCCTGCTTTTGG + Intronic
1029194008 7:98791604-98791626 CTGTCAGGAGCTCCTGTTCCTGG - Intergenic
1030494634 7:110283653-110283675 CTGGTAGCACTTCATGTTTTTGG - Intergenic
1030566982 7:111169763-111169785 CAATTAGGACTTCATGTTTTGGG + Intronic
1031744860 7:125482055-125482077 CTGTAATGAATTCCTTTTTTTGG + Intergenic
1034522837 7:151633148-151633170 TTTTCAGGACTTCCTCTTTCAGG - Intronic
1034846995 7:154455501-154455523 CTGTCAGAACTCCCTCCTTTTGG - Intronic
1035005253 7:155653025-155653047 GTGTCAGAACTTCCTTTTTAAGG + Intronic
1037773252 8:21815555-21815577 CTTTCAGGACTTCTTCCTTTGGG - Intergenic
1038406814 8:27328276-27328298 CTGTCATGATTCCCAGTTTTAGG + Intronic
1038566972 8:28627754-28627776 GTGTCAGAACTTCCTTTTTAAGG - Intronic
1038751709 8:30302090-30302112 CTGTAAAGACTTCCTGGTTAGGG - Intergenic
1041160947 8:55043629-55043651 CAGGAGGGACTTCCTGTTTTGGG + Intergenic
1042130726 8:65584704-65584726 CTTGCAGTACTTCCTCTTTTAGG - Intergenic
1043696118 8:83220344-83220366 CTGTTAGGAGTTCCTATTGTAGG + Intergenic
1043911010 8:85864104-85864126 TTGACAGGACTTCATGTCTTAGG - Intergenic
1047688675 8:127328571-127328593 CTCTCCAGACTTCCTATTTTGGG + Intergenic
1048798841 8:138177360-138177382 ATGTCAGGACTGCAAGTTTTTGG + Exonic
1048815637 8:138331187-138331209 TAGTCAGTACTTCATGTTTTTGG - Intronic
1048851410 8:138648843-138648865 CTGTCAAGACTTCCTACTTGAGG + Intronic
1051230347 9:14949371-14949393 CTCTCTGGATTTCCTGTTTTTGG - Intergenic
1055388717 9:75795011-75795033 CTGTCATGGCTTCCTATCTTGGG + Intergenic
1056349517 9:85735194-85735216 GTGTCAGGACTTTCTTTTTAAGG - Intronic
1061298328 9:129689333-129689355 CTCTCAGGACTGCCAGATTTCGG + Intronic
1061878852 9:133558348-133558370 CAGACACGACTTCCTGTGTTTGG - Intronic
1188129271 X:26411102-26411124 CTGTCTGGCTTTCCTGTATTCGG - Intergenic
1190370542 X:49736273-49736295 CTGTCTGGAGTCACTGTTTTAGG - Intergenic
1194235047 X:91372577-91372599 CAGTCAGGGCTCCCTGGTTTGGG + Intergenic
1195663453 X:107405500-107405522 TTGTCAGGACTTCCTTTTCTTGG - Intergenic
1197324573 X:125076373-125076395 ATATCATGGCTTCCTGTTTTGGG + Intergenic
1198723498 X:139650850-139650872 GTGTCAGAACTTCCTTTTTAAGG - Intronic
1202079808 Y:21072590-21072612 GAGTCAAGACTTCCTGTATTGGG - Intergenic