ID: 969274475

View in Genome Browser
Species Human (GRCh38)
Location 4:6125441-6125463
Sequence AGGACTTCCTGTTTTGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969274464_969274475 21 Left 969274464 4:6125397-6125419 CCACTCTCCCAGCTCCATCTATG 0: 1
1: 0
2: 4
3: 37
4: 475
Right 969274475 4:6125441-6125463 AGGACTTCCTGTTTTGGGTCAGG No data
969274463_969274475 27 Left 969274463 4:6125391-6125413 CCAATGCCACTCTCCCAGCTCCA 0: 1
1: 0
2: 3
3: 58
4: 476
Right 969274475 4:6125441-6125463 AGGACTTCCTGTTTTGGGTCAGG No data
969274469_969274475 7 Left 969274469 4:6125411-6125433 CCATCTATGGCTACAGTGGCCCA 0: 1
1: 0
2: 1
3: 6
4: 108
Right 969274475 4:6125441-6125463 AGGACTTCCTGTTTTGGGTCAGG No data
969274466_969274475 14 Left 969274466 4:6125404-6125426 CCCAGCTCCATCTATGGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 969274475 4:6125441-6125463 AGGACTTCCTGTTTTGGGTCAGG No data
969274467_969274475 13 Left 969274467 4:6125405-6125427 CCAGCTCCATCTATGGCTACAGT 0: 1
1: 0
2: 2
3: 9
4: 171
Right 969274475 4:6125441-6125463 AGGACTTCCTGTTTTGGGTCAGG No data
969274462_969274475 28 Left 969274462 4:6125390-6125412 CCCAATGCCACTCTCCCAGCTCC 0: 1
1: 0
2: 1
3: 33
4: 352
Right 969274475 4:6125441-6125463 AGGACTTCCTGTTTTGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969274475 Original CRISPR AGGACTTCCTGTTTTGGGTC AGG Intronic
No off target data available for this crispr