ID: 969276770

View in Genome Browser
Species Human (GRCh38)
Location 4:6141049-6141071
Sequence CGCTGTGAATGCTGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969276770 Original CRISPR CGCTGTGAATGCTGGGCAGG GGG (reversed) Intronic
900160343 1:1220330-1220352 CGCGGTGAAGGCGTGGCAGGCGG - Intronic
900199614 1:1398565-1398587 CGCTGGGAATGAAGTGCAGGAGG + Intronic
900646291 1:3710182-3710204 CTCTGTGGATGCTGGGGCGGGGG + Intronic
900917527 1:5649319-5649341 TGCTTGGAATCCTGGGCAGGGGG - Intergenic
900923253 1:5687276-5687298 TGCTGTGCATGCTGGGCGGGGGG - Intergenic
902710052 1:18232994-18233016 GGCTTTGCCTGCTGGGCAGGCGG - Intronic
902783523 1:18719000-18719022 CTCTGAGATTGCTGGGGAGGGGG - Intronic
903241171 1:21983682-21983704 CGATGTCATTGCTGGGGAGGAGG - Exonic
903244679 1:22006866-22006888 CGATGTCATTGCTGGGGAGGAGG - Exonic
903737187 1:25537486-25537508 CCCTGTGGATGCTAGGCTGGGGG + Intergenic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
905879705 1:41455612-41455634 AGCAGTGAATGCTGGGCACAGGG - Intergenic
907497238 1:54853253-54853275 AGCTGTGAAAGATGGGCAGGGGG - Intronic
913395554 1:118367339-118367361 ATCAGTGAATGCTGAGCAGGAGG - Intergenic
915473009 1:156137001-156137023 CACCCTGAAGGCTGGGCAGGTGG + Exonic
923246526 1:232137666-232137688 CACTGAGAACGCTGGGCAGAAGG - Intergenic
924048238 1:240054278-240054300 CTCTGGGAATGCAGCGCAGGAGG - Intronic
924267831 1:242300836-242300858 CCGTGTGAATGCTGGGGATGGGG + Intronic
1063085678 10:2815705-2815727 TCCTGTGAAAGCTGGGGAGGTGG + Intergenic
1063377946 10:5565333-5565355 CGGTGTGAGTATTGGGCAGGAGG + Intergenic
1071669290 10:87592888-87592910 AGCTGTGAATACTGGGCTAGAGG - Intergenic
1074126421 10:110531988-110532010 CACTGTTAATGCTGGGCTGTGGG - Intergenic
1076913241 10:133402779-133402801 TGCAGTGAATGCAGGGCAGCTGG + Intronic
1077231710 11:1460739-1460761 CGCTGTCAGTGCTGTGCTGGGGG - Exonic
1078832102 11:14987714-14987736 CCCTGTGGAGGCTGTGCAGGAGG - Intronic
1079928570 11:26527903-26527925 AGCTGTGAAAGCAGGGCATGGGG - Intronic
1080650063 11:34215170-34215192 TGCTGCCATTGCTGGGCAGGGGG + Intronic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1084091675 11:66882907-66882929 GGCTGAGATTTCTGGGCAGGGGG + Intronic
1084889102 11:72228048-72228070 CCCTGTGCAGCCTGGGCAGGTGG + Intronic
1087936243 11:104037180-104037202 CCCTGTGACCGCTGGGCAGCGGG - Exonic
1089078910 11:115760308-115760330 CGCAGAGACAGCTGGGCAGGCGG + Intergenic
1089551496 11:119282627-119282649 ACTTGTGAAAGCTGGGCAGGAGG + Intronic
1090438040 11:126703095-126703117 GGCTGTGAATCCTGGTCAGGTGG + Intronic
1091609721 12:1995638-1995660 GTCTGTGTATGCTGGGCAGGAGG - Intronic
1092387575 12:8047992-8048014 GGCTGGGACTGCTGGGGAGGTGG - Exonic
1100532563 12:95474053-95474075 CGCAGGGAATGCTGGGACGGCGG - Exonic
1101739678 12:107491258-107491280 GGGTGTGAAGGCTGGGCATGTGG - Intronic
1101987023 12:109455254-109455276 TCCTGTGAGTGCTGGGGAGGAGG + Intronic
1106777195 13:33019899-33019921 AGCTGTGAAGGCTGAGCAGTTGG - Intronic
1107823781 13:44309293-44309315 TGATGTGGATGCTGGGCAGATGG - Intergenic
1108546857 13:51503550-51503572 CGCTGAGTATGGTGGGGAGGGGG - Intergenic
1108711566 13:53038028-53038050 AGCTGTGAATGTTAGGCTGGTGG + Intronic
1109325315 13:60860181-60860203 ACCTCTGAAGGCTGGGCAGGTGG - Intergenic
1113649468 13:112025908-112025930 GGCTGAGAATCCTGGGCAGAAGG + Intergenic
1113752421 13:112785459-112785481 CGCTGTGAGCCCTGGGCAGGTGG - Intronic
1113787737 13:113011482-113011504 CGGTGTGGATGGTGGACAGGTGG + Intronic
1113787827 13:113011932-113011954 CGGTGTGGATGGTGGACAGGCGG + Intronic
1113787850 13:113012055-113012077 CAGTGTGAATGGTGGACAGGTGG + Intronic
1113849338 13:113409118-113409140 CTCTTTGAAAGCTGGGCTGGTGG - Intergenic
1113917331 13:113882366-113882388 CCCTGTGAGAGCTGGGCTGGAGG + Intergenic
1114166510 14:20224196-20224218 GTCTGTGTATGCTGGGTAGGCGG + Exonic
1114459722 14:22878700-22878722 AGCTGTGAATTCTAGACAGGGGG + Exonic
1119149479 14:72345161-72345183 CTCTGTGAAAGGTGGGAAGGAGG - Intronic
1119162878 14:72467812-72467834 TGCTGTGATTGCTGGGCATTGGG - Intronic
1119748146 14:77059081-77059103 CGTTGTGCAGGCTGGACAGGAGG - Intergenic
1120387235 14:83862009-83862031 CGCTGTGGATGCTGGAGTGGCGG + Intergenic
1121486889 14:94323214-94323236 TGCTCTGGAGGCTGGGCAGGGGG + Intronic
1121767949 14:96503203-96503225 GCCTGTGAATGCTAGGGAGGCGG - Intronic
1122853151 14:104547483-104547505 CGCTGGGAATTCCGGGCAGGCGG + Intronic
1123961142 15:25402361-25402383 CAGTGTGAAGGCTGGGTAGGTGG + Intronic
1124905656 15:33866156-33866178 CTCTGTGACTGCTGGGAAAGGGG + Intergenic
1129035558 15:72646573-72646595 AGATGTTAGTGCTGGGCAGGGGG - Intergenic
1129193114 15:73949007-73949029 CTCAGTGAATGTTGGGCACGTGG + Intronic
1129214326 15:74090643-74090665 AGATGTTAGTGCTGGGCAGGGGG + Intergenic
1129242004 15:74257454-74257476 CCCTGGGATTGCTGGGCAGGGGG - Intronic
1129399681 15:75274724-75274746 AGATGTTAGTGCTGGGCAGGGGG - Intronic
1129473225 15:75766587-75766609 AGATGTTAGTGCTGGGCAGGGGG + Intergenic
1130107987 15:80943296-80943318 TGCTGTGAATGTAGGTCAGGCGG + Intronic
1132248342 15:100315130-100315152 TGCTAGGAATGCTGGGCTGGAGG + Intronic
1132925066 16:2424932-2424954 TGCTGTGACGGCTGGGCTGGAGG - Intergenic
1135045424 16:19151109-19151131 AGCCGTGAATGCTGGGCAATGGG + Intronic
1135973629 16:27090275-27090297 CCTTGTTACTGCTGGGCAGGAGG - Intergenic
1137287179 16:47026126-47026148 CACTGTGAATGCTGAGTAGAAGG + Intergenic
1139643601 16:68311106-68311128 CGCTGGGTATGCTGGGAAGGTGG + Intronic
1140188203 16:72793154-72793176 CCCTCTGAGTGCTGGGCAGATGG - Intronic
1141974195 16:87503837-87503859 CGCTGTCTACGCTGGGCAAGCGG - Intergenic
1142287478 16:89177272-89177294 GGCTGTGAGCGCTGGGCATGTGG + Intronic
1142734090 17:1883690-1883712 CTGTGTGAAAGCTGGGCGGGTGG + Intronic
1144698764 17:17323099-17323121 CCCTGTGAAGGCAGGGCAGGTGG + Intronic
1144735642 17:17553914-17553936 GGCTGTGACTGCCGGGCAGCGGG - Intronic
1144949820 17:18988093-18988115 CTATGTGACTGCTTGGCAGGAGG + Intronic
1145081900 17:19901136-19901158 TACTGTGGATTCTGGGCAGGTGG - Intergenic
1145986595 17:29051285-29051307 GGTGGTGAATGCTGGGTAGGCGG + Intronic
1146491147 17:33283267-33283289 CCCTGTGAATGCTGATAAGGAGG - Intronic
1147150074 17:38509435-38509457 GCCTGTAGATGCTGGGCAGGTGG + Intronic
1147805000 17:43125114-43125136 CGTTGTGAACCCTGGGGAGGGGG - Intronic
1148438793 17:47701193-47701215 AGCTGTGATAGCTGGGGAGGTGG + Intronic
1151975990 17:77483745-77483767 CTCTGGGAATGGTGCGCAGGAGG + Intronic
1152070205 17:78130574-78130596 CTCTGTGCATGCTGGGCTGCGGG - Intronic
1152070430 17:78131473-78131495 CTCTGTGCACGCTGGGCTGGGGG - Exonic
1152155281 17:78628984-78629006 AGCTGTGCACACTGGGCAGGTGG - Intergenic
1152384240 17:79960827-79960849 CACTGTGAGTGCTGGCCAGGAGG + Intronic
1154122159 18:11660789-11660811 TGCTTTGCCTGCTGGGCAGGAGG - Intergenic
1154311028 18:13266289-13266311 AGCTGTGAATGCAGGGCTGGAGG - Intronic
1155272747 18:24156782-24156804 CTCTGACAATACTGGGCAGGAGG + Exonic
1157221118 18:45829049-45829071 CACTATGGAGGCTGGGCAGGGGG + Intronic
1157518832 18:48330785-48330807 GGCTGTGAGGGCTGGGCAGGGGG + Intronic
1157700258 18:49757803-49757825 CGCAGTGGATGCTGGACAGTGGG - Intergenic
1159324356 18:66894986-66895008 TGATGTGAATGCTGGTCATGGGG + Intergenic
1160011153 18:75107928-75107950 AGCTGTGAATTCTGGGCTGGGGG - Intergenic
1162386716 19:10364595-10364617 TGCTGTGAGTGCTGGGTGGGGGG - Exonic
1163266163 19:16223805-16223827 AGCTCTGAAACCTGGGCAGGAGG - Intronic
1164648618 19:29876232-29876254 CGCTCTGCCTTCTGGGCAGGTGG - Intergenic
1165665909 19:37627916-37627938 GGATGTGAATGGTGGCCAGGAGG + Intronic
1166000289 19:39873534-39873556 CGCTGTGAGTGTGGGCCAGGTGG - Exonic
1166319174 19:42005938-42005960 TACCGTGAATTCTGGGCAGGAGG + Exonic
1167503042 19:49857974-49857996 TCCTGTGAGTGCTGGGCTGGGGG + Exonic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
927637602 2:24827505-24827527 GGCTGTGAGTGCAGGCCAGGAGG + Intronic
927961479 2:27242970-27242992 AGCTGTGAGTGCTGGGCTTGAGG + Exonic
929317856 2:40502030-40502052 TGCTATGGATGCTGGGCAAGGGG - Intronic
929877315 2:45807629-45807651 AGCCATGAATGTTGGGCAGGTGG - Intronic
934040499 2:88124236-88124258 CCCTGGGCATGCAGGGCAGGTGG + Intronic
935242905 2:101193608-101193630 CTCTGTGAATCCGAGGCAGGAGG + Intronic
936858734 2:116990966-116990988 AGCTGTGAATGCAGGGCATGAGG + Intergenic
936961628 2:118081144-118081166 TCCTGTGAATGCTAGGTAGGTGG + Intergenic
937429054 2:121823387-121823409 TGCTGTGAAACCTGGCCAGGAGG - Intergenic
938121623 2:128638144-128638166 CACTGGGAATACTGGGGAGGGGG + Intergenic
938173170 2:129101004-129101026 CCCCGTGAATGCTGGGGAGCGGG + Intergenic
939057385 2:137381532-137381554 TGCTGTGAATGCAGGCCTGGAGG + Intronic
941724426 2:168845624-168845646 CACTGGGAATGCTGAGAAGGGGG - Intronic
946398505 2:219455855-219455877 CCCTCTGGGTGCTGGGCAGGAGG + Intronic
948018826 2:234713281-234713303 GGCTAAGAATGATGGGCAGGTGG + Intergenic
948542474 2:238700444-238700466 CGGTGTAAATGCTGAGCAGTGGG + Intergenic
948840252 2:240645255-240645277 GGCTGAGAATGTAGGGCAGGAGG - Intergenic
1168974174 20:1951767-1951789 GGCTGTGTGAGCTGGGCAGGAGG - Intergenic
1169068340 20:2707013-2707035 AGCTGTGCATGCTGGCAAGGAGG + Intronic
1169323441 20:4654899-4654921 CCCTGTAAATGCTGGGCAAAAGG + Intergenic
1172061095 20:32188139-32188161 AGCTGTGGGTGCTGGGGAGGGGG - Intergenic
1172112856 20:32557559-32557581 AGCCGTTAATGGTGGGCAGGGGG + Intronic
1172636309 20:36412262-36412284 AGCTCTGACTGCAGGGCAGGCGG - Intronic
1172832177 20:37845381-37845403 CTCTGTGAATGCTGGGAGAGTGG - Intronic
1172889935 20:38257028-38257050 GGCTCTGAAGGGTGGGCAGGAGG - Intronic
1174082746 20:47982820-47982842 CGCAGTGGGTGGTGGGCAGGGGG - Intergenic
1174404032 20:50292376-50292398 CACTCTGACTGATGGGCAGGGGG - Intergenic
1175751994 20:61504969-61504991 CGCTGCAAATGTTGGGGAGGGGG + Intronic
1175988472 20:62776120-62776142 AGCTGTGGGTGCTGGGCAGGTGG - Intergenic
1176158672 20:63637180-63637202 CCATCTGAAGGCTGGGCAGGAGG - Intergenic
1176458271 21:6931790-6931812 TGCTCTCAATGCTGGGCAGGGGG + Intergenic
1176836445 21:13796884-13796906 TGCTCTCAATGCTGGGCAGGGGG + Intergenic
1177825225 21:26075591-26075613 CGCTGTAAATTCTGGGCATCAGG - Intronic
1178019612 21:28394161-28394183 TGCTGTGAATGCAGGCCTGGAGG + Intergenic
1178684046 21:34697470-34697492 CACTTTGAATGCTGAGGAGGTGG - Intronic
1179633536 21:42693037-42693059 CCGTGGGAAGGCTGGGCAGGTGG + Intronic
1180041434 21:45282278-45282300 CTCCGTGCATGCTGGGCTGGGGG - Intronic
1180623350 22:17177059-17177081 TACTTTGGATGCTGGGCAGGAGG + Intergenic
1180880408 22:19199401-19199423 TGCTGAGAATACTGGGCTGGTGG - Intronic
1180918515 22:19506195-19506217 CACTGTGATGGCTGGGAAGGAGG + Intronic
1180952658 22:19727654-19727676 CGCTGTGGATGCTGTGGGGGTGG + Intergenic
1180952675 22:19727738-19727760 CGCTGTGGATGCTGTGGGGGTGG + Intergenic
1181059685 22:20276425-20276447 GCCTGTGAAGGTTGGGCAGGGGG - Intronic
1181427685 22:22855088-22855110 CGGTGTGAGTGCTGGGCGGGAGG - Intronic
1182828119 22:33283219-33283241 TGCTGTCAATGCTGGACATGGGG - Exonic
1185168996 22:49281281-49281303 CCCTGTGAGTGCTGGGCTGCTGG + Intergenic
1185241495 22:49749860-49749882 CGCTGTGACTGGTGGGATGGAGG - Intergenic
949220992 3:1633624-1633646 CGGAGTGAATGCTCTGCAGGCGG - Intergenic
952691394 3:36210553-36210575 TGCTCAGAAGGCTGGGCAGGGGG + Intergenic
953472237 3:43177289-43177311 CACTGGCAATGCTGGGCAGAAGG + Intergenic
955472520 3:59300734-59300756 CCCTGTGAGTGTTGGGGAGGTGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
966896395 3:184448335-184448357 CCCTGGGAATGCTGTCCAGGAGG + Intronic
968984057 4:3865894-3865916 AGTTGTGAAAGCTGGACAGGTGG + Intergenic
969276770 4:6141049-6141071 CGCTGTGAATGCTGGGCAGGGGG - Intronic
971490730 4:27209618-27209640 CCCAGTGAATGCAGAGCAGGTGG - Intergenic
973650477 4:52992861-52992883 CGGGGTGACTGCTGGGCAGAGGG - Intronic
974182722 4:58403849-58403871 AGCTGTGAATCCTAGGGAGGAGG + Intergenic
976087848 4:81424505-81424527 AGCTGGGACTGCTGGGAAGGTGG - Intergenic
978902276 4:113966486-113966508 TGCTGTCAATGCTGGTCAGTTGG + Intronic
982192615 4:152873682-152873704 GGCTGTGAAGGCTGGGATGGAGG - Intronic
982259146 4:153479136-153479158 CAGTGTGAATTCTGGGCAGCAGG + Intronic
982629606 4:157815333-157815355 TGCTCTGAATGGTGGACAGGTGG - Intergenic
984702972 4:182830162-182830184 AGATCTGAATGCTGGGGAGGAGG - Intergenic
984765519 4:183397925-183397947 CGCTGTGAAGGCTCTGGAGGAGG + Intergenic
985525925 5:401590-401612 AGCTGTGAAGCCAGGGCAGGCGG + Intronic
985558245 5:568655-568677 GGCTGTGAATGTGGGGCAAGGGG - Intergenic
985890016 5:2708236-2708258 CGGTGTGAATGCTGGGGACAGGG - Intergenic
988959508 5:36355619-36355641 CCCTGGGAATTCTGGCCAGGTGG + Intergenic
989603958 5:43226298-43226320 CCCTGTTAAAGGTGGGCAGGAGG + Intronic
990042317 5:51389608-51389630 CGCCGTGAGCGCTGGGCTGGAGG - Intronic
992442365 5:76808194-76808216 TGCTGTGTATGCTGGGCCAGGGG - Intergenic
994177724 5:96729984-96730006 AGCTGTGACTGCAGGGCAGCAGG + Intronic
996805229 5:127447097-127447119 TGCTGAGTAGGCTGGGCAGGAGG + Intronic
997454416 5:134006272-134006294 CACTGAGACTGGTGGGCAGGGGG + Intergenic
998351431 5:141504573-141504595 TGCTGTGAATCCTGGGCAGATGG - Intronic
1000367819 5:160507308-160507330 CTCTCAGAATGCTGGGGAGGAGG - Intergenic
1002105807 5:176878970-176878992 GGCGGTGAGAGCTGGGCAGGGGG + Intronic
1002302793 5:178267050-178267072 CACTGTGGATGCTGGACAGTGGG - Intronic
1002401182 5:178992303-178992325 TTCCGTGAATGCTGTGCAGGTGG + Intronic
1003872554 6:10413828-10413850 AGCTGAGAATGTTAGGCAGGAGG - Intronic
1004339869 6:14798747-14798769 GGCTGAGAATGTTGGGGAGGGGG - Intergenic
1004895276 6:20141978-20142000 CACTGTGCATTCTAGGCAGGAGG - Intronic
1005456022 6:26020753-26020775 CGCTGTGATGGCTCTGCAGGAGG + Exonic
1005765459 6:29006948-29006970 GGATGTGAATGCTGGACAGTAGG - Intergenic
1006780062 6:36626536-36626558 AGTGGTGAATACTGGGCAGGGGG + Intergenic
1007415482 6:41688982-41689004 AGGTGTGTACGCTGGGCAGGTGG - Intronic
1007702564 6:43773312-43773334 CTCTGCGAGTGCTGGGCGGGAGG + Intronic
1007878919 6:45140183-45140205 CGCTGTGGAGGATGGGGAGGGGG - Intronic
1011663324 6:89612767-89612789 CGCTATAGATGCTGGGCATGGGG - Intronic
1018062053 6:160097815-160097837 CACTGTTAAGGGTGGGCAGGGGG - Intronic
1018897861 6:168033574-168033596 CTATGTGAATGCTGAGCTGGTGG + Intronic
1019755321 7:2764492-2764514 CACTGTGAATACTGGGCAACTGG - Intronic
1020030420 7:4929050-4929072 AGGAGTGAAAGCTGGGCAGGGGG + Intronic
1023053413 7:36272914-36272936 AGCTCTGAATGCTAGGCATGTGG + Intronic
1024650446 7:51398897-51398919 CCTTGTGACTGCTGGGCATGGGG + Intergenic
1025888478 7:65621947-65621969 CACTGAGAATGCTGGGCTTGGGG + Intergenic
1026382831 7:69816500-69816522 AGCTGTGAATGCTGTGCACGGGG - Intronic
1031033608 7:116762819-116762841 CACAGTTTATGCTGGGCAGGTGG + Intronic
1031853964 7:126900015-126900037 CACTGAGAATGCTGGGCTTGGGG - Intronic
1033118309 7:138645538-138645560 TGCTGTGGAGGCTGGGCATGAGG - Intronic
1035399894 7:158557870-158557892 TGCTGGGAATGCTGGGAAGAGGG - Intronic
1036219964 8:6913232-6913254 CCCTGTGAATGCTTGGAGGGAGG + Intergenic
1039591974 8:38757165-38757187 CGCTGGGAAAGCGGGGAAGGAGG - Intronic
1041858199 8:62481909-62481931 TGCTGTGAATGGTGGTTAGGTGG + Intronic
1042110240 8:65374008-65374030 CACTGGGACTACTGGGCAGGAGG + Intergenic
1042935729 8:74056167-74056189 TGCCATGAAAGCTGGGCAGGTGG - Intergenic
1044850145 8:96419725-96419747 CGCAGTGCATGCTGGGAAGGGGG - Intergenic
1049057998 8:140254251-140254273 CCCTGTGTATCCTGGGCAGTGGG + Intronic
1049143708 8:140981471-140981493 CACTGTTGAAGCTGGGCAGGAGG + Intronic
1049278691 8:141733012-141733034 CGCTGTGTACCCTGGGCAAGAGG + Intergenic
1049586389 8:143434497-143434519 GGGTGGGAACGCTGGGCAGGGGG + Intergenic
1049924340 9:394222-394244 GTCTCTGAATGCTGGGAAGGGGG - Intronic
1051310082 9:15760824-15760846 CTCTGTAAATACTGGACAGGTGG + Intronic
1053384706 9:37677702-37677724 CACTGTGAAAGCTTGGAAGGAGG + Intronic
1055681560 9:78721038-78721060 GGCTGTGAGTGCTGAGGAGGAGG + Intergenic
1057129604 9:92644390-92644412 CTCTGTGGCTGCTGGGCAGCTGG - Intronic
1057229187 9:93308581-93308603 GGCTGTGAGTGCGGGGCGGGTGG + Exonic
1057593617 9:96395341-96395363 CTCTGGGATTGCTGTGCAGGGGG - Intronic
1057698784 9:97348103-97348125 CTCTGTTAATGCGGGGCGGGGGG + Intronic
1060504760 9:124189489-124189511 CGCTGAGTAGGCTGGGGAGGAGG + Intergenic
1060870176 9:127033655-127033677 CACTGAGAATGCTGGGCATTTGG + Intronic
1061245295 9:129398464-129398486 CGCAGTGAGGGCTGGGCAAGGGG + Intergenic
1061592229 9:131605064-131605086 CTCTGAGACTGGTGGGCAGGTGG + Intronic
1061629733 9:131864639-131864661 CGCAGAGCAAGCTGGGCAGGTGG + Intronic
1062106737 9:134759036-134759058 GGCTGAGAAAGCAGGGCAGGCGG - Intronic
1062273535 9:135720485-135720507 AGCTGGGAGGGCTGGGCAGGAGG - Intronic
1189180962 X:39004135-39004157 GGCTGTGGAGGCTGGGCTGGAGG + Intergenic
1189929293 X:45990882-45990904 CGCTGTAAGAGGTGGGCAGGAGG - Intergenic