ID: 969278105

View in Genome Browser
Species Human (GRCh38)
Location 4:6150555-6150577
Sequence TGCCTCGGAGGCAGCTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969278097_969278105 12 Left 969278097 4:6150520-6150542 CCGCATCCAGGAATAGACACCCG 0: 1
1: 0
2: 1
3: 2
4: 56
Right 969278105 4:6150555-6150577 TGCCTCGGAGGCAGCTCCCACGG No data
969278100_969278105 -8 Left 969278100 4:6150540-6150562 CCGCTTCTTAATCCCTGCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 159
Right 969278105 4:6150555-6150577 TGCCTCGGAGGCAGCTCCCACGG No data
969278099_969278105 -7 Left 969278099 4:6150539-6150561 CCCGCTTCTTAATCCCTGCCTCG 0: 1
1: 0
2: 1
3: 18
4: 139
Right 969278105 4:6150555-6150577 TGCCTCGGAGGCAGCTCCCACGG No data
969278098_969278105 6 Left 969278098 4:6150526-6150548 CCAGGAATAGACACCCGCTTCTT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 969278105 4:6150555-6150577 TGCCTCGGAGGCAGCTCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969278105 Original CRISPR TGCCTCGGAGGCAGCTCCCA CGG Intronic