ID: 969279082

View in Genome Browser
Species Human (GRCh38)
Location 4:6157314-6157336
Sequence TCCCGTGCGCCTTTTTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969279082_969279087 2 Left 969279082 4:6157314-6157336 CCTCTGCAAAAAGGCGCACGGGA 0: 1
1: 0
2: 1
3: 0
4: 44
Right 969279087 4:6157339-6157361 GGAAGCTGGCGCACAACACAGGG 0: 1
1: 0
2: 1
3: 7
4: 103
969279082_969279086 1 Left 969279082 4:6157314-6157336 CCTCTGCAAAAAGGCGCACGGGA 0: 1
1: 0
2: 1
3: 0
4: 44
Right 969279086 4:6157338-6157360 GGGAAGCTGGCGCACAACACAGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969279082 Original CRISPR TCCCGTGCGCCTTTTTGCAG AGG (reversed) Intronic
902071901 1:13747225-13747247 TCCCATGCTCTTTTTTGCATTGG + Intronic
914004206 1:143718201-143718223 TCCAGTGCACCTTTCTGCCGCGG + Intergenic
916898327 1:169191272-169191294 ACCCATGCTCCTTATTGCAGAGG - Intronic
917296793 1:173528089-173528111 TCCCATGCGCTTTTGTGCAAAGG - Intronic
923505894 1:234607194-234607216 TCCCCTGGGCCTTTATGCAAGGG - Exonic
1075697932 10:124449605-124449627 TCCCGTGCGCCTTCTCTCTGAGG + Intronic
1081557543 11:44179585-44179607 TCCCTTTCCCCTTTTTTCAGGGG + Intronic
1089442466 11:118528813-118528835 TCCCGTGGGCCCTTTTGCAGAGG - Intronic
1091557008 12:1581423-1581445 TTCTGTGCTCCGTTTTGCAGAGG - Intronic
1094269982 12:28602772-28602794 CCCCGTGGGCTCTTTTGCAGTGG - Intergenic
1097889887 12:64767340-64767362 TCCCATGATCCTTTCTGCAGGGG - Intergenic
1102098174 12:110257088-110257110 TCCCGTGAGGCTTGTGGCAGAGG + Intergenic
1110813254 13:79834103-79834125 TCCATTGCACGTTTTTGCAGAGG + Intergenic
1114969499 14:28007288-28007310 TCCCGTGCTTCTTTTTGTACTGG - Intergenic
1119741652 14:77017672-77017694 TCCAGTGTTCCTTTGTGCAGAGG - Intergenic
1134584205 16:15396557-15396579 TCCCGTGGGCCTTTTTCAGGGGG - Intronic
1136192085 16:28622759-28622781 TCCCGTGGGCCTTTTTCAGGGGG + Intronic
1151235365 17:72716099-72716121 TCCCTTGGGCCTTTTTGGGGTGG - Intronic
1151402403 17:73864398-73864420 TCCCCTGGGCCTGTTTCCAGAGG - Intergenic
1161620545 19:5294715-5294737 TTCCATGCTCCATTTTGCAGAGG - Intronic
928815193 2:35285395-35285417 TCCCGTGAGTCTTTATCCAGTGG + Intergenic
929153606 2:38770119-38770141 TCCCTAGAGCCTTTCTGCAGCGG - Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932199381 2:69812268-69812290 TCCCGACCCCCTTTTGGCAGAGG + Intronic
1177967285 21:27744106-27744128 TCACGTGCTCCCTTTTGCAAAGG - Intergenic
1181028702 22:20139904-20139926 TCCTGTGGGCCTCATTGCAGAGG + Intronic
1181911911 22:26245111-26245133 TCCCGTGCCCCTTTGTGGTGGGG + Intronic
951618244 3:24572079-24572101 TCCCTTGCCCCTTTTTGATGGGG - Intergenic
953058874 3:39410361-39410383 TCCCATGTGTGTTTTTGCAGAGG + Intronic
955954856 3:64278337-64278359 CCCAGTGCTGCTTTTTGCAGGGG - Intronic
960060654 3:113317268-113317290 TCCCGAGTGCCTTTGTGCATTGG + Intronic
963123827 3:141797415-141797437 TCCTCTGCGCCTTTAAGCAGTGG - Intronic
969279082 4:6157314-6157336 TCCCGTGCGCCTTTTTGCAGAGG - Intronic
993256409 5:85595856-85595878 TCCAGTGAGAATTTTTGCAGAGG - Intergenic
993404981 5:87500033-87500055 TCACGTGCTCCTTTCTGCATGGG + Intergenic
997315780 5:132934373-132934395 TCCCGTGTACCTTTTTCAAGTGG - Exonic
1008128041 6:47690570-47690592 TCTGGAGCTCCTTTTTGCAGAGG - Intronic
1021925911 7:25533503-25533525 TCCCTTGAGCCTTTTTACAAAGG + Intergenic
1024007614 7:45238756-45238778 TCCCGAGAGCCTATTTACAGTGG - Intergenic
1048927497 8:139284081-139284103 GCCTGTGCGCCTGCTTGCAGAGG - Intergenic
1053308936 9:37003021-37003043 CCCCGTGTTCCTTTCTGCAGGGG - Intronic
1186715267 X:12244762-12244784 TCCAGTGGGTCTGTTTGCAGAGG + Intronic
1186715273 X:12244798-12244820 TCCAGTGGGTCTGTTTGCAGAGG + Intronic
1188127838 X:26392335-26392357 TCCCATAGGTCTTTTTGCAGAGG + Intergenic
1193117183 X:77786359-77786381 TCCCCTCCACCTTTTCGCAGGGG + Intergenic
1198197749 X:134381817-134381839 TCCCGTGAGCCTGTTTGCTTTGG + Intronic