ID: 969279815

View in Genome Browser
Species Human (GRCh38)
Location 4:6162181-6162203
Sequence CACTGCCCTCTAGTGGGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969279815_969279820 -2 Left 969279815 4:6162181-6162203 CCTCGTCCCACTAGAGGGCAGTG 0: 1
1: 0
2: 0
3: 9
4: 158
Right 969279820 4:6162202-6162224 TGGGAGCGACTGCAGACCACTGG No data
969279815_969279821 8 Left 969279815 4:6162181-6162203 CCTCGTCCCACTAGAGGGCAGTG 0: 1
1: 0
2: 0
3: 9
4: 158
Right 969279821 4:6162212-6162234 TGCAGACCACTGGTCTTATGAGG 0: 1
1: 0
2: 1
3: 8
4: 101
969279815_969279825 30 Left 969279815 4:6162181-6162203 CCTCGTCCCACTAGAGGGCAGTG 0: 1
1: 0
2: 0
3: 9
4: 158
Right 969279825 4:6162234-6162256 GAATGGGACCTCTCAGCTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 166
969279815_969279822 13 Left 969279815 4:6162181-6162203 CCTCGTCCCACTAGAGGGCAGTG 0: 1
1: 0
2: 0
3: 9
4: 158
Right 969279822 4:6162217-6162239 ACCACTGGTCTTATGAGGAATGG 0: 1
1: 0
2: 0
3: 5
4: 116
969279815_969279824 14 Left 969279815 4:6162181-6162203 CCTCGTCCCACTAGAGGGCAGTG 0: 1
1: 0
2: 0
3: 9
4: 158
Right 969279824 4:6162218-6162240 CCACTGGTCTTATGAGGAATGGG 0: 1
1: 0
2: 1
3: 11
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969279815 Original CRISPR CACTGCCCTCTAGTGGGACG AGG (reversed) Intronic
901752411 1:11418767-11418789 CACTGTCCTCTAGTAGGGAGAGG - Intergenic
902805989 1:18861721-18861743 CCCTGACCTCTCCTGGGACGGGG + Intronic
907407288 1:54261457-54261479 CTCTGACCTTTGGTGGGACGGGG + Intronic
909810053 1:79922534-79922556 CACTGCCCTCTCCTGGGATTAGG + Intergenic
910968673 1:92832390-92832412 TACTGCCGTCTAGTGTGAGGGGG + Intronic
912587637 1:110781051-110781073 CGCTGCCCTCTGGTGGTAAGAGG + Intergenic
913524124 1:119674990-119675012 TACTGGCCTCTAGTGGGCAGAGG + Intronic
1064040636 10:11960135-11960157 CACTGGCATCTAGTGGGTAGAGG - Intronic
1065477626 10:26157929-26157951 TACTGACCTCTAGTGGGTAGAGG + Intronic
1065946263 10:30607979-30608001 CACTGCCCTCTAGTCTGGCTGGG - Intergenic
1066669004 10:37817123-37817145 CACTGCCCTCAAATGGGAGCTGG + Intronic
1067278203 10:44852480-44852502 CACTGCCCTCAAGTGAGAGTGGG + Intergenic
1067816353 10:49480281-49480303 CACTGCCCTGTACTGGGACCAGG + Intronic
1067832202 10:49616711-49616733 CCCTGCCCTCTACTGGCACAAGG + Intronic
1068971841 10:62967069-62967091 TACTGGCCTCTAGTGAGAAGAGG + Intergenic
1069447570 10:68487627-68487649 TACTGGCATCTAGTGGGAAGAGG - Intronic
1069560293 10:69424501-69424523 CACTGCCCTCCAGTAGGAAGTGG - Intergenic
1072415208 10:95241510-95241532 CACTGGCGTCTAGTGGGCAGAGG + Intronic
1072693875 10:97589228-97589250 CTCTGCCCTGTAGTGAGGCGAGG + Intronic
1075159598 10:120011661-120011683 CACAGCCCTCTGGAGGAACGCGG + Intergenic
1075279553 10:121128079-121128101 CACTGGCATCTAGTGGGTTGAGG - Intergenic
1077275749 11:1706833-1706855 CATTGCCCTCCATTGGGATGTGG + Intergenic
1078987879 11:16612756-16612778 CATTCCCCTCTAATGAGACGCGG + Intronic
1079494121 11:21022004-21022026 GACTGGCATCTAGTGGGAAGAGG - Intronic
1079977343 11:27108182-27108204 CACTGGCCTCTACAGGGATGGGG - Intronic
1081679911 11:44994879-44994901 CACTGCACCCTAGTGGGCCTGGG - Intergenic
1085015928 11:73173996-73174018 TACTGCCCTCTAGCCGGAAGAGG - Intergenic
1085834137 11:79934427-79934449 CACTGCCATCTAGGTGGAGGAGG + Intergenic
1087140649 11:94762424-94762446 CACTGGCATCTAGTGGGTAGAGG + Intronic
1089629176 11:119773236-119773258 CACTGCCCTCTATGGAGACACGG - Intergenic
1090698285 11:129270924-129270946 CACTGGCATCTAGTGGGTAGAGG - Intronic
1090978377 11:131694992-131695014 CACTGCCCTCTGGTGGCAGCAGG - Intronic
1094479324 12:30869310-30869332 CACTGCCCTCTAGGTTGAGGAGG + Intergenic
1097221961 12:57456310-57456332 CTCTGCCCTCTAGTGGCTTGAGG + Exonic
1099263291 12:80411344-80411366 CTCTGCCCTCTAGTCTGACAAGG + Intronic
1100564874 12:95785965-95785987 CACTGGCATCTAGTGGGTGGAGG - Intronic
1101432977 12:104641991-104642013 TACTGTCCTCTAGTGGGTTGAGG + Intronic
1101889385 12:108698782-108698804 CACTGACTTGTAGTGGGACGTGG - Intronic
1102745979 12:115249455-115249477 CACTGGCATCTAGTGGGTAGAGG + Intergenic
1103084899 12:118055262-118055284 TACTGCCATCTAGTGGGTGGAGG + Intronic
1103101793 12:118182449-118182471 TACTGCCATCTAGTGGGTAGAGG - Intronic
1107131874 13:36905121-36905143 CACTGGCCTCTAGTGGGCAGAGG + Intronic
1107275241 13:38670779-38670801 TACTGCTCTCTAGTGGGTAGAGG - Intergenic
1110414135 13:75234038-75234060 CACTGGCCTCTAGTAGGCAGAGG - Intergenic
1110691791 13:78439123-78439145 CACTGGCATCTAGTGGGTAGAGG - Intergenic
1113772114 13:112916986-112917008 GACTGCCCTGGAGTGGGAAGAGG - Intronic
1113988578 13:114339980-114340002 CTCTGCCCTCTAGTGGATCCTGG + Intergenic
1116558470 14:46344522-46344544 TACTGACCTCTAGTGGGAAGAGG + Intergenic
1117309019 14:54503678-54503700 TACTGGCCTCTAGTGGGTAGAGG - Intergenic
1119666041 14:76485846-76485868 CAATGCCCTCTCGTGAGATGCGG - Intronic
1121221968 14:92292364-92292386 CACTGCCCTTTGGTGGGCCTCGG - Intergenic
1124223983 15:27873250-27873272 CACTGGCATCTAGTGGCACCAGG - Intronic
1124783917 15:32661278-32661300 CACTGGCATCTAGTGGGTAGAGG - Intronic
1127435855 15:58957541-58957563 TACTGCCATCTAGTGGGTAGAGG - Intronic
1127637194 15:60882319-60882341 CACTGACCTCTAATGGGCAGAGG + Intronic
1128368191 15:67019646-67019668 CACTGGCATCTAGTGGGTAGAGG + Intergenic
1129945238 15:79533946-79533968 CACTGGCATCTAGTGGGTAGAGG + Intergenic
1131496215 15:92913458-92913480 TACTGGCCTCTAGTGGGTAGAGG + Intronic
1133619585 16:7513583-7513605 TACTGCCATCTAGTGGGTGGAGG - Intronic
1133769423 16:8859182-8859204 CACTGCCCACTCGCCGGACGAGG - Exonic
1134241943 16:12512984-12513006 CACTGCCCTCTGGGGGGACAAGG - Intronic
1134357883 16:13501210-13501232 AACTGGCATCTAGTGGGAAGAGG + Intergenic
1135350070 16:21721418-21721440 TACTGGCCTCTAGTGGGTAGAGG + Intronic
1135861073 16:26056559-26056581 CTCTTCCCTCTAGTGTGAGGTGG + Intronic
1138442916 16:57045964-57045986 GGCTGCCCTCTAGTGGGACCAGG + Intronic
1139351658 16:66340207-66340229 CACTGTCCTCTAGTGGGTGAAGG + Intergenic
1140376619 16:74450034-74450056 CACAGCCCTCTAGAGGTACCTGG - Intergenic
1140898949 16:79350654-79350676 CTCTGCCCTCTACTGGGTCCTGG - Intergenic
1141065202 16:80908559-80908581 TCCTGACCTCTAGTGGGTCGAGG - Intergenic
1141284591 16:82659851-82659873 CAATGGCCTCTAGTGGGTAGAGG - Intronic
1142710525 17:1720964-1720986 CCCTGCCCTCTAGCGGTACTGGG - Intronic
1145765413 17:27455978-27456000 GGCTGCCATCTAGTGGGAAGGGG - Intergenic
1149496185 17:57119209-57119231 CAGTGTCCTCTAGTGGGTAGAGG + Intronic
1150623042 17:66822762-66822784 CACTGGCATCTAGTGGGTAGAGG - Intergenic
1150713301 17:67549760-67549782 CACTGTCCTCTTGTGGGCAGGGG - Intronic
1151449173 17:74187251-74187273 CACTGGCATCTAGTGGGTAGAGG - Intergenic
1157230420 18:45910594-45910616 CACTGCCCTCTGCTGGAACACGG + Exonic
1157425714 18:47582661-47582683 CACTGGCATCTAGAGGGAGGAGG - Intergenic
1157788384 18:50507298-50507320 CACTGCCCTCAAGTGGCCTGTGG - Intergenic
1160366842 18:78333859-78333881 CCCTTCCCTCTAGTGGGTCTTGG + Intergenic
1160366854 18:78333907-78333929 CCCTTCCCTCTAGTGGGTCTTGG + Intergenic
1161219725 19:3112976-3112998 CACTGCCCTCCTGTGGGTCCTGG + Intronic
1162339702 19:10085273-10085295 CACTGGCATCTAGTGGGTGGAGG + Intergenic
1165139058 19:33688305-33688327 CCCTGCCCTCTAGGAGGAAGCGG + Intronic
1165652090 19:37500457-37500479 TACTGGCATCTAGTGGGAAGAGG - Intergenic
1165827531 19:38713838-38713860 CACTGCCCCCTAGCAGGACAGGG + Intronic
1165865260 19:38932963-38932985 TACTGCCCTCTGCTGGGAAGGGG + Exonic
1166476582 19:43131058-43131080 AACTGGCATCTAGTGGGAAGAGG + Intronic
1166740579 19:45112589-45112611 CCCTGCCCTCTAGTGGCCAGTGG + Intronic
924959215 2:18827-18849 CTCTGCCCTCTAGTGGATCCTGG - Intergenic
927481878 2:23460436-23460458 TACTGGCCTCTAGTGGGTGGAGG + Intronic
927646705 2:24881857-24881879 TACTGGCCTCTAGTGGGCGGAGG + Intronic
929644429 2:43612637-43612659 TACTGCCATCTAGTGGGGAGTGG - Intergenic
931538170 2:63301084-63301106 CAGTGCCACCTAGTGGGACAGGG + Intronic
935397887 2:102627272-102627294 CACTGCACTCCAGTGGGAGTGGG + Intronic
936489640 2:112959002-112959024 TACTGCCATCTAGTGGGGAGAGG + Intergenic
938074105 2:128322776-128322798 CCCTGCCCTCGCGTGTGACGTGG + Intergenic
938954508 2:136285445-136285467 CCCTCCCCTCTAGTGGTACTTGG + Intergenic
944556151 2:200889540-200889562 CACAGCGCACTAGTGGGACAGGG + Exonic
945662803 2:212707210-212707232 CACTGCCCTCTTGTGGGGGAGGG + Intergenic
949006963 2:241655204-241655226 CCCTGACCTCTGGTGGCACGTGG - Intronic
1168801610 20:647011-647033 CACTGCCCTCTAAGGGAACTTGG - Exonic
1168885388 20:1248816-1248838 CATTGCACTCTAGTGGGATTTGG - Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1172706703 20:36887369-36887391 CACTGCCATCCAGTGGTTCGGGG + Intronic
1173222099 20:41138776-41138798 CGCTGGTCTCTAGTGGGAGGAGG + Intronic
1173703868 20:45095970-45095992 TACTGCCCTCTAGTGGGTAAAGG + Intronic
1174605300 20:51757080-51757102 CACTGGCATCTAGTGGGCAGAGG + Intronic
1175663563 20:60838649-60838671 CACTGGCATCTAGTGGGCAGAGG - Intergenic
1178024578 21:28451845-28451867 TACTGGCATCTAGTGGGAAGAGG - Intergenic
1181572673 22:23776182-23776204 CTCTGCCCTCTAGTGAGTCCTGG - Intronic
1181685588 22:24525619-24525641 GACTGCCCTCCAGTGGCAAGAGG + Intronic
1184179848 22:42813355-42813377 GACTGCCCTGGAGTGGGAAGAGG + Intronic
950315483 3:11998335-11998357 CTCTGGCCTCTTGTGGGATGCGG - Intergenic
950566102 3:13770558-13770580 CTCTGCCCTATGGTGGGAGGGGG - Intergenic
954126953 3:48536945-48536967 GACTGGGCTCTAGTGGGAGGAGG - Intronic
957953988 3:87160434-87160456 CACTGGCATCTAGTGGGTAGAGG + Intergenic
961123219 3:124391997-124392019 CTTTGCCCTCTAGTGGGAACTGG + Intronic
961456904 3:127028913-127028935 CACAGCAGTGTAGTGGGACGGGG - Intronic
961930855 3:130531319-130531341 CACTGACATCTAGTGGGTAGAGG - Intergenic
962827706 3:139112005-139112027 CAGTGCCATCTAGTGGGAGCCGG - Intronic
963675808 3:148309585-148309607 TACTGCCATCTAGTGGGTAGAGG - Intergenic
966554055 3:181238855-181238877 CACTGGCATCTAGTGGGTAGAGG + Intergenic
968374688 4:29275-29297 CTCTGCCCTCTAGTGGATCCTGG - Intergenic
968985756 4:3873542-3873564 CCCTGCCCTCTTGTGTGAAGAGG + Intergenic
969279815 4:6162181-6162203 CACTGCCCTCTAGTGGGACGAGG - Intronic
975235385 4:71989553-71989575 CACTGGCATCTAGTGGGTAGAGG + Intergenic
977564082 4:98563856-98563878 CACTGGCATCTAGTGGGTAGAGG + Intronic
977996167 4:103499320-103499342 TACTGGCCTCTAGTGGGTGGAGG - Intergenic
982258065 4:153468698-153468720 CACTGGCATCTAGTGGGTAGAGG - Intronic
988354901 5:30161249-30161271 CACTGGCCTCTAGTTGGCTGGGG + Intergenic
991474220 5:67002945-67002967 CACTGGCATCTAGTAGGTCGAGG + Intronic
991502727 5:67293215-67293237 CAAAGCCCTCTTGTGGGATGTGG + Intergenic
994224033 5:97231219-97231241 CACTGCCCCCTAGAGGAACAAGG - Intergenic
997199988 5:132004097-132004119 AAGTGCCCTCGAGTGGGAGGTGG + Intronic
998429614 5:142059760-142059782 TACTGCCCTCTTGTGAGAAGGGG + Intergenic
1001606122 5:172960967-172960989 CACTGGCATCTAGTGGGGAGAGG - Intronic
1002755675 6:157333-157355 CTCTGCCCTCTAGTGGATCCTGG - Intergenic
1003672516 6:8172677-8172699 AAGTGCCATCTAGTGGGACAAGG - Intergenic
1003961250 6:11211249-11211271 CTCTGCCCTCTGGAAGGACGGGG + Intronic
1006097028 6:31662457-31662479 CACTGTCCTCAAGAGGGACCAGG - Exonic
1017702408 6:157088197-157088219 ACCTGCCCTCTTGTGGGAAGGGG + Intronic
1019780802 7:2938614-2938636 CACTGCCCCCTGGTGTGAAGGGG + Intronic
1020827402 7:13047241-13047263 TACTGGCCTCTAGTGGGTGGTGG - Intergenic
1021313090 7:19116704-19116726 CTCCGCCTGCTAGTGGGACGCGG + Exonic
1024064607 7:45722012-45722034 CACTGCCCTCACCTGGGAGGTGG - Exonic
1024235088 7:47391807-47391829 CACAGCCCTCTTGTGTGACGAGG + Intronic
1033556544 7:142492892-142492914 CACTGCCCTCTAGGAGGGCTCGG + Intergenic
1040529588 8:48255794-48255816 AACTGGCCTCTACTGGAACGGGG - Intergenic
1044902789 8:96966572-96966594 TACTGGCTTCTAGTGGGAAGAGG - Intronic
1045144802 8:99329936-99329958 CACTGGTATCTAGTGGGAAGAGG - Intronic
1045492926 8:102684025-102684047 CACTGGCATCTAGTGGGTGGAGG + Intergenic
1049781442 8:144430810-144430832 CAGTGCCCTCATGTGGGCCGAGG + Intronic
1051220854 9:14846950-14846972 CACTGCCCTCTAGTGGCGGCAGG + Intronic
1055849216 9:80605315-80605337 CACTGCTCTCTAGTGGAATAAGG - Intergenic
1060105398 9:120869907-120869929 CACTGCCCGCTATGGGGATGTGG + Exonic
1061306932 9:129737744-129737766 CACTGCCCCCTGGTGGTAAGGGG - Intergenic
1061551318 9:131336419-131336441 CAGCGCCCTCTAGTGGGAAAAGG + Intergenic
1203574532 Un_KI270744v1:164876-164898 CTCTGCCCTCTAGTGGATCCTGG + Intergenic
1186186629 X:7026694-7026716 AACTGGCATCTAGTGGGAAGAGG + Intergenic
1186614867 X:11175722-11175744 TACTGGCATCTAGTGGGAAGAGG + Intronic
1186663452 X:11693627-11693649 CACTGCCCTGGAGTGTGACGAGG + Intergenic
1187029507 X:15471184-15471206 TACTGCCATCTAGTGGGTAGAGG - Intronic
1187442274 X:19331210-19331232 TACTGGCATCTGGTGGGACGAGG - Intergenic
1188025099 X:25200027-25200049 CACTGGCGTCTAGTGGGTAGAGG + Intergenic
1189705526 X:43755651-43755673 CAATGCCCTCTCCTGGGACAGGG + Intergenic
1190053714 X:47170203-47170225 CACTGCCCTCTGGAGGGTCCAGG + Intronic
1198880755 X:141278474-141278496 TACTGCCATCTAGTGGGTAGAGG + Intergenic