ID: 969279840

View in Genome Browser
Species Human (GRCh38)
Location 4:6162337-6162359
Sequence CAGCTAAGGCAGCCAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969279838_969279840 -6 Left 969279838 4:6162320-6162342 CCGAGCTTGCATCTGTGCAGCTA 0: 1
1: 0
2: 0
3: 6
4: 128
Right 969279840 4:6162337-6162359 CAGCTAAGGCAGCCAGAGCCTGG 0: 1
1: 0
2: 3
3: 33
4: 269
969279837_969279840 13 Left 969279837 4:6162301-6162323 CCAGGACACTGCACTGCAGCCGA 0: 1
1: 0
2: 1
3: 23
4: 529
Right 969279840 4:6162337-6162359 CAGCTAAGGCAGCCAGAGCCTGG 0: 1
1: 0
2: 3
3: 33
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969279840 Original CRISPR CAGCTAAGGCAGCCAGAGCC TGG Intronic
900169968 1:1262345-1262367 CAACTAGGGCAGCCAGAGTGCGG - Intronic
900230125 1:1552481-1552503 CAGCTCAGGCACCAAGACCCTGG - Intronic
900516946 1:3086630-3086652 CAGCTGCAGCAGCCAGACCCAGG + Intronic
900705724 1:4078851-4078873 CAGCTGATGCACCCAGACCCAGG + Intergenic
900765103 1:4499766-4499788 CAAATAAGACAGGCAGAGCCAGG - Intergenic
900934820 1:5758629-5758651 GGGCCAGGGCAGCCAGAGCCCGG + Intergenic
901399174 1:9004470-9004492 CAGCAAACAAAGCCAGAGCCAGG - Intronic
901681306 1:10914417-10914439 GAGAGAAGTCAGCCAGAGCCAGG - Intergenic
902221546 1:14969084-14969106 CTGCAAAGGCAGCCAGGGCATGG - Intronic
902515691 1:16988302-16988324 CAGGTAAGGCAGGCAGGGACCGG - Exonic
902630779 1:17703137-17703159 AAGAGAAGGCAGCCAGTGCCGGG + Intergenic
903502918 1:23811669-23811691 CAGCTGAGGCAGACAGAGCAAGG + Intronic
903812258 1:26041350-26041372 GAGAGAAGGCAGCCAGAGCCTGG + Intronic
904295940 1:29519776-29519798 CAGCTTGGGCAGCAGGAGCCAGG - Intergenic
904982785 1:34520966-34520988 TAGCTAAGGCACTTAGAGCCTGG + Intergenic
905652155 1:39663702-39663724 CAGCTATGGCAGCTATGGCCAGG - Intronic
906077490 1:43062893-43062915 CATCAAACGCAGCCTGAGCCTGG + Intergenic
906149339 1:43578421-43578443 CCACTAAGCCAGTCAGAGCCAGG - Intronic
906302846 1:44696132-44696154 CAACTATGGCAGCAAGAGGCAGG + Intronic
907524517 1:55046451-55046473 CAGCAAACACAGCCACAGCCTGG - Intronic
907590836 1:55669468-55669490 CAGCCAAGGAAGGAAGAGCCTGG - Intergenic
908401053 1:63773688-63773710 CAGCTGAGGCTGCTAGAACCTGG + Intergenic
910507960 1:87971740-87971762 CAGCACAGGCATCCATAGCCAGG + Intergenic
911484589 1:98489395-98489417 CACCTAAGGCAGCAAGAACAAGG - Intergenic
913069352 1:115285221-115285243 CAGCCAGGGAAGCCAGAGACGGG - Intergenic
914395066 1:147258430-147258452 AAGCTAATTCAGACAGAGCCAGG + Intronic
915273046 1:154768688-154768710 CAGCTAAGGGAAGGAGAGCCCGG + Intronic
915488890 1:156240808-156240830 CAGCCAGGGCAGCCAAAGGCAGG + Intronic
916395356 1:164380997-164381019 CAGCTGACTCAGCCACAGCCCGG - Intergenic
916500643 1:165384054-165384076 CAGCTAATGCTGCCAGTGTCAGG - Intergenic
916502463 1:165398746-165398768 GGACTTAGGCAGCCAGAGCCTGG - Intergenic
916875182 1:168961433-168961455 TAGTTAAGGCAGTCAGACCCTGG - Intergenic
917089257 1:171336495-171336517 CAACAAAAGCAGACAGAGCCTGG + Intronic
918568226 1:185955709-185955731 CAGCTCTGGCAGCCAAAGACAGG - Intronic
920297879 1:204970433-204970455 CAGCCAAGCCAGCCAGAAACAGG + Intronic
920819501 1:209367175-209367197 AGGCTAAGCCAGCCAGAGCCTGG - Intergenic
921312724 1:213860732-213860754 CAGAAGACGCAGCCAGAGCCTGG + Intergenic
924657590 1:245987472-245987494 GAACTAAAGAAGCCAGAGCCAGG + Intronic
1063222791 10:3986339-3986361 GAACTAAGGCACCCAGACCCAGG - Intergenic
1064251608 10:13710447-13710469 CAGCTACAGCAGCCACAGACGGG - Intronic
1065094043 10:22263382-22263404 GAGCTGAGGGAACCAGAGCCAGG - Intergenic
1067508655 10:46877320-46877342 GGGCTGGGGCAGCCAGAGCCAGG - Intergenic
1067653594 10:48174530-48174552 GGGCTGGGGCAGCCAGAGCCAGG + Intronic
1070820639 10:79352140-79352162 CAGCAAAGGCAGGCATACCCTGG + Intronic
1071485592 10:86099991-86100013 CAGGGAAGGAGGCCAGAGCCTGG + Intronic
1072310638 10:94150940-94150962 CAGCTCAGACTGCCAGAACCTGG - Intronic
1075054328 10:119206904-119206926 CAGCGCGGGCAGCCAGCGCCGGG + Intergenic
1075062302 10:119265641-119265663 CAGCTCAGGCTGCCATAGACTGG - Intronic
1075590185 10:123685459-123685481 CAGCTCAGCCAGCCACAGCCGGG + Intronic
1075653103 10:124142987-124143009 CAGGTAAGGCCACCAGAGGCCGG + Intergenic
1075922559 10:126225207-126225229 TAGCAAAGGCAGCCAGCTCCTGG - Intronic
1076273161 10:129174455-129174477 CACCTACCGCAGACAGAGCCTGG + Intergenic
1076549664 10:131270250-131270272 GCGCAAAGCCAGCCAGAGCCTGG + Intronic
1076628753 10:131839899-131839921 CAGCTGAGGCAGAGAGAGACAGG + Intergenic
1076805716 10:132857703-132857725 CAGCTACGGCACCCTGGGCCAGG + Exonic
1077268129 11:1662062-1662084 GGGGTAAGGCAGCCACAGCCAGG - Intergenic
1077393937 11:2312048-2312070 CAGGCAGGGCAGGCAGAGCCAGG + Intronic
1077911251 11:6572832-6572854 CAGCGTATGCAGCCAGAGCATGG + Intronic
1078375804 11:10792300-10792322 CAGGTAAGTCAGATAGAGCCTGG + Intergenic
1081724805 11:45320844-45320866 CAGCTATGCAAGCCAGAGCCTGG - Intergenic
1083158864 11:60842365-60842387 CCCCAAGGGCAGCCAGAGCCAGG + Exonic
1086419311 11:86622736-86622758 CAACGATGGCAGCCAGAGTCAGG - Intronic
1087036182 11:93758588-93758610 GAGCAAAGTCAGGCAGAGCCCGG + Intronic
1088631115 11:111774795-111774817 CAGGAAAGACAGCCAGGGCCAGG - Intergenic
1090855045 11:130603494-130603516 CAGCGTAGGCAGCCTGATCCTGG - Intergenic
1091305337 11:134532665-134532687 CAGCTAATGCACCCATACCCAGG - Intergenic
1091682199 12:2535092-2535114 CAATTAAAGCAGCTAGAGCCGGG + Intronic
1098935347 12:76472655-76472677 CAGCTGAGGCAGAGAGAGACAGG + Intronic
1100390264 12:94141280-94141302 CAGGACAGGCAGCCAGAGCGGGG - Intergenic
1102934579 12:116885633-116885655 CAGTAAAAGCAGCCAGAGTCTGG - Intergenic
1103200049 12:119080661-119080683 CAGCTAGGGGTGGCAGAGCCAGG + Intronic
1103953637 12:124565343-124565365 CAGGGAAGCCAGACAGAGCCCGG + Intronic
1104070990 12:125345187-125345209 CAACTCAGGCATCGAGAGCCAGG - Intronic
1106455811 13:29925639-29925661 CAGACAAGGAAGCCAGTGCCAGG + Intergenic
1110031086 13:70614803-70614825 CACCTAAGGCAGCAAGAACAAGG + Intergenic
1110926896 13:81164800-81164822 CAGCTAAGGGACCCTGGGCCTGG + Intergenic
1112047398 13:95612330-95612352 CACCTAGAGCAGCCAGGGCCAGG - Intronic
1113959123 13:114116044-114116066 CAGGTCACACAGCCAGAGCCTGG + Intronic
1118322781 14:64763169-64763191 CTTCTGAGGCACCCAGAGCCTGG + Intronic
1118797053 14:69153094-69153116 CAGCCATGGCAGGCAGAGCGAGG + Exonic
1119427474 14:74545210-74545232 CATCTAGGGCAGGTAGAGCCAGG - Intronic
1120509737 14:85398801-85398823 AAGCTAAAGAAGCCACAGCCAGG - Intergenic
1121303514 14:92890350-92890372 CATCGCAGGCAGCCAGGGCCAGG - Intergenic
1121850653 14:97218887-97218909 CCACAAAGGCAGCCTGAGCCAGG + Intergenic
1122088348 14:99322263-99322285 CACCAAAGCCACCCAGAGCCAGG + Intergenic
1122672744 14:103384952-103384974 CAGTTAAGGATGCAAGAGCCCGG + Intergenic
1124844192 15:33274883-33274905 TAGCAAAGCCAGCCAGAGCCGGG + Intergenic
1127078102 15:55348098-55348120 CAGCTGAGGCAGGCTGAGGCAGG - Intronic
1128419481 15:67478086-67478108 CAGAAAAGGCAGACAGAGGCTGG + Intronic
1129458969 15:75690416-75690438 CAGGGAAGGCAGCCAGAGAGTGG + Exonic
1129525047 15:76208476-76208498 CAGAGAAGGATGCCAGAGCCAGG + Intronic
1129724840 15:77896476-77896498 CAGGGAAGGCAGCCAGAGAGTGG - Intergenic
1130272923 15:82461678-82461700 CAGGCAAGGCAGCCAGAGAGTGG - Intergenic
1130465272 15:84189031-84189053 CAGGCAAGGCAGCCAGAGAGTGG - Intergenic
1130487416 15:84405771-84405793 CAGGCAAGGCAGCCAGAGAGTGG + Intergenic
1130498994 15:84484505-84484527 CAGGCAAGGCAGCCAGAGAGTGG + Intergenic
1130587564 15:85193644-85193666 CAGGCAAGGCAGCCAGAGAGTGG - Intergenic
1131233992 15:90680867-90680889 CAGCTAAGCCAGGCAGACACGGG + Intergenic
1131391028 15:92048990-92049012 CAGATGAGGCAGCCAAAGCCTGG + Intronic
1131402215 15:92134237-92134259 CAGCTCTGGCAGACAGGGCCAGG - Intronic
1131577133 15:93603408-93603430 CAGTTAAGGCAGACAGTGGCGGG - Intergenic
1133298454 16:4767103-4767125 CAGCCAGGGACGCCAGAGCCGGG + Exonic
1134686493 16:16162337-16162359 CAGCTAATACTGGCAGAGCCAGG - Intronic
1135518179 16:23152533-23152555 CAGCACAGGCAGACAGAGACGGG + Intergenic
1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG + Intergenic
1138870040 16:60871540-60871562 CAGATGAGGCAGCCAGAGTGAGG + Intergenic
1139884276 16:70197577-70197599 CTGCCAAGGCAGACAGAGCCTGG + Intergenic
1140368240 16:74397919-74397941 CTGCCAAGGCAGACAGAGCCTGG - Intergenic
1141322599 16:83025849-83025871 AATCTAATGCAGACAGAGCCAGG - Intronic
1141891520 16:86929633-86929655 GGGCTAGGGCAGCCAGACCCTGG - Intergenic
1142037533 16:87870912-87870934 CAGCCCAGGCAGCCACAGGCGGG + Intergenic
1142156236 16:88533944-88533966 CAGCGAGGGCAGCCAGAGCCCGG + Exonic
1142592124 17:1010878-1010900 CAGCTAAGGCTGCCTGACCTCGG - Intronic
1142717005 17:1752722-1752744 CAGCTTAGGCAGCCGGACCTTGG - Exonic
1143215453 17:5221506-5221528 CAGTGAAGGCAGCCACAGCATGG + Intronic
1143723981 17:8832958-8832980 CAGCGAGGCCAGCCCGAGCCGGG - Exonic
1144471221 17:15543142-15543164 CAGCCAAGACAGCAAGAGCCTGG + Intronic
1144925245 17:18801551-18801573 CAGCCAAGAGAGCAAGAGCCTGG - Intronic
1146802587 17:35838524-35838546 CAGCTAAGGCAGCCATTGACTGG + Exonic
1147608168 17:41785905-41785927 CCGCTGAAGAAGCCAGAGCCGGG + Intronic
1147757358 17:42777887-42777909 CTGCTAGGGCAGCCAGGGCCTGG - Intronic
1150288099 17:63965425-63965447 CAGGGAAGGCAGGCTGAGCCTGG - Intronic
1151349446 17:73522973-73522995 AAGCTGTGGCAGCCACAGCCGGG - Intronic
1152463264 17:80452191-80452213 CAGCTTAAGCAGCCACTGCCTGG + Intergenic
1153814282 18:8779475-8779497 CAGCTCAGGCAGCGGGAGGCTGG - Intronic
1155063389 18:22247980-22248002 CAGCCAGGGCCTCCAGAGCCTGG + Intergenic
1158186348 18:54776204-54776226 CTGCTCAGGCAGGCAAAGCCTGG + Intronic
1160560860 18:79755038-79755060 CAGCGGAGACAGCCTGAGCCTGG - Exonic
1160808101 19:1001256-1001278 CAGCCCAGCCACCCAGAGCCGGG - Intronic
1161021312 19:2013021-2013043 CAGCTAAGGACGACAGAGACAGG + Intronic
1161256259 19:3311517-3311539 CAGCTGAGGCCGGCAGAGCCCGG - Intergenic
1161451116 19:4345932-4345954 CAGCTGGTGCAGCCGGAGCCAGG - Exonic
1162951379 19:14073670-14073692 CCGCAGAGGCTGCCAGAGCCTGG + Exonic
1163710760 19:18845385-18845407 CAGCAAAGGCAGACAGCGCATGG - Intronic
1164389577 19:27806080-27806102 CAGCCAAGGCAGCCTGGGCCTGG - Intergenic
1164436485 19:28234736-28234758 CAAGAGAGGCAGCCAGAGCCTGG - Intergenic
1164629506 19:29752840-29752862 CAGTCGAGCCAGCCAGAGCCGGG - Intergenic
1164682735 19:30146319-30146341 CAGCCAGGGCAGCCAGGGCGGGG + Intergenic
1164743651 19:30595074-30595096 TGGCCAAGGAAGCCAGAGCCAGG + Intronic
1165081803 19:33311251-33311273 CAGGCAAGGCTGCCAGGGCCTGG + Intergenic
1166162242 19:40963046-40963068 CAGCTAATGAGGGCAGAGCCTGG - Intergenic
1166402297 19:42492385-42492407 CAGTTAAGACAGCCAGGGCCAGG + Intergenic
1167143884 19:47670931-47670953 CTTCTAAGGCAGCGAGAGCCCGG + Intronic
1167681918 19:50928800-50928822 CAGCTCAGGGAGACAGAGTCAGG - Intergenic
1168246847 19:55116895-55116917 CAGCACAGGCTGCCAAAGCCAGG + Intronic
1168568226 19:57442143-57442165 GTGATAAGGCAGCCAGAGCTGGG + Intronic
1168581287 19:57557731-57557753 CGGCTAAGGAAGCCTTAGCCTGG - Intronic
925593338 2:5531544-5531566 AAGCTAAAGCAGCTAAAGCCTGG - Intergenic
926608053 2:14917403-14917425 CATCAAAGCCAGCCAGAGACAGG + Intergenic
926891270 2:17640985-17641007 CAGCAATGGCAGCCAGAGCCAGG - Intronic
927361176 2:22236002-22236024 CAACTAAGGCCACTAGAGCCTGG + Intergenic
927504307 2:23603246-23603268 CAGAAAAGGCAGCCAGAGGTAGG + Intronic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
928141166 2:28730557-28730579 AAGCTAATGCAGCCAGAGTATGG + Intergenic
928172620 2:29013046-29013068 CAGCTGAGGCTGCCTGAGGCTGG - Intronic
928405571 2:31011878-31011900 GCGTTATGGCAGCCAGAGCCAGG - Intronic
928457386 2:31434859-31434881 CAGTTAAGGGAGACAGAGCATGG + Intergenic
929514265 2:42592148-42592170 CAGCTAAGGGAGGCTGAGGCAGG + Intronic
929768155 2:44868124-44868146 CAGTTACGGCATCCAGATCCAGG + Intergenic
930949639 2:57124393-57124415 TAGCTGAGGCAGCCAGAGAAGGG - Intergenic
933778319 2:85785213-85785235 CCGCCCAGGCAGCCAGCGCCGGG + Intronic
935382441 2:102466305-102466327 CATCACAGGAAGCCAGAGCCAGG + Intergenic
935976999 2:108587861-108587883 CTGCTGGGGCAGCCAGAGCCTGG + Intronic
937285682 2:120749641-120749663 AAGCTATGACAGTCAGAGCCTGG + Intronic
937439337 2:121903271-121903293 CCGCTGAGGGAGCCAGAGCCGGG + Intergenic
940375946 2:152958937-152958959 CAGCTAAGACAGACAGAAGCTGG + Intergenic
941303387 2:163830582-163830604 CAGCTAGGGCAGCCAAAGGAGGG - Intergenic
942443126 2:176056603-176056625 CTGCTAAGGCAGCCTCAGCCTGG - Intergenic
945011093 2:205464495-205464517 CAGCTAGAGCAGCCAGAGAGGGG + Intronic
945386616 2:209209332-209209354 CAGCTGGGGCAGCCCGGGCCGGG + Intergenic
945937582 2:215918640-215918662 CACCCAAGGCAGCCAGAACAAGG + Intergenic
946336204 2:219038343-219038365 CAGCCAGGGCAGGCAGAGCAGGG - Intronic
946382617 2:219359016-219359038 CAGCGACCGCGGCCAGAGCCAGG + Intergenic
948275152 2:236702828-236702850 CAGGTAAGGGAGGGAGAGCCAGG - Intergenic
948338642 2:237231338-237231360 CAGCTGAGACAGCCTGAGCAGGG - Intergenic
948789194 2:240368682-240368704 CAGCCAAGACAGGCAGAGCCTGG + Intergenic
948861620 2:240755315-240755337 CAGCAGAGGCAGACAGAGCGAGG + Intronic
948992743 2:241563075-241563097 CAGGTGAGGCAGGCACAGCCAGG - Intronic
949042033 2:241853936-241853958 CAGCTGTGGCAACCAGGGCCTGG - Intronic
1170099252 20:12680751-12680773 CAGCTGGGGCAGCCACAGGCCGG + Intergenic
1170589831 20:17763393-17763415 CAGATAGGACTGCCAGAGCCTGG - Intergenic
1171486643 20:25490679-25490701 CAGCTCAGACAGCCATTGCCAGG + Intronic
1172768833 20:37365243-37365265 CAGCTATGAGAGACAGAGCCAGG + Exonic
1172920217 20:38474595-38474617 AAGCTAATGCAGCCAGAGACAGG - Intronic
1175404577 20:58717930-58717952 CAGCTGCTGCAGCCAGACCCTGG + Intronic
1175414403 20:58792412-58792434 CATCTCTGCCAGCCAGAGCCTGG + Intergenic
1176138868 20:63536541-63536563 CAGCTGTGGAAGCCAGGGCCAGG + Intronic
1178344383 21:31812247-31812269 CAGCAAGGTCAGCAAGAGCCAGG + Intergenic
1178431743 21:32523671-32523693 CAGATAAGGAACCCACAGCCAGG + Intergenic
1179219979 21:39398113-39398135 CAGGGAACGCAGCCACAGCCTGG + Intronic
1179514710 21:41898696-41898718 GAGCAAAGCCAGGCAGAGCCTGG - Intronic
1180132533 21:45835697-45835719 CAGCCTAGTCTGCCAGAGCCAGG - Intronic
1180950525 22:19718671-19718693 CCGGTCAGGCCGCCAGAGCCCGG - Intronic
1180980990 22:19877870-19877892 CTGTTGAGCCAGCCAGAGCCAGG - Intronic
1182269102 22:29142274-29142296 CTGCCAGGGCAGGCAGAGCCTGG + Intronic
1182380551 22:29883624-29883646 CTGGGAAGGCAGCCCGAGCCCGG - Intronic
1182429684 22:30292346-30292368 CAGCTAAGGCCTCCAGGGCGGGG - Exonic
1184103874 22:42356062-42356084 CAGCAAAGTCAGCCTGATCCAGG + Intergenic
1184309393 22:43631463-43631485 TAGATGAGGCAGCCTGAGCCAGG - Intronic
1184334775 22:43846731-43846753 CAGGCAAGGCAGCCACACCCTGG - Intronic
1185239465 22:49734967-49734989 CAGCTCAGGCATCCGGAGCAGGG - Intergenic
949867950 3:8562260-8562282 CAGTTAATGTAGCCAGTGCCTGG - Intronic
952897106 3:38085071-38085093 CAGGTAAGCATGCCAGAGCCTGG - Intronic
953139450 3:40213929-40213951 CAGCTGAGGCAGTCAGTGCATGG - Intronic
953449987 3:42997854-42997876 CAGGGAAGGCAGCCAGTGCAGGG + Intronic
953884503 3:46707735-46707757 CACTGACGGCAGCCAGAGCCGGG - Intronic
954076927 3:48188286-48188308 CAGCGAAGACAGCGTGAGCCTGG - Exonic
954873537 3:53785660-53785682 CACTTAAGACAGCCTGAGCCAGG + Intronic
957337875 3:78855401-78855423 CTGCAAAGTCAGGCAGAGCCTGG + Intronic
957674217 3:83346320-83346342 CATCTAAGGCCGCCTCAGCCTGG - Intergenic
957680631 3:83428580-83428602 CAGCTGAGGCAGGCTGAGGCAGG + Intergenic
958606536 3:96364863-96364885 CAGTAATGGCAGCCAGTGCCAGG - Intergenic
961018037 3:123482371-123482393 CTGCCAAGGCAGGCAGAGTCAGG - Intergenic
961453776 3:127014458-127014480 CAGCTGAGGGAGGCAGAGGCTGG - Exonic
961505126 3:127365555-127365577 GAGCAAAGGCAGACAGAGCAGGG - Intergenic
962957758 3:140281856-140281878 CAGCTAAAGCAGCTTGTGCCTGG - Intronic
963397970 3:144757319-144757341 CAGCTAATGGATCCCGAGCCAGG - Intergenic
966638604 3:182163222-182163244 CAGCTAATGATCCCAGAGCCAGG - Intergenic
968964278 4:3761653-3761675 CGGCTAAGGAGGCTAGAGCCAGG + Intergenic
969117333 4:4878919-4878941 CAGATGAGGAAGCCACAGCCCGG + Intergenic
969279840 4:6162337-6162359 CAGCTAAGGCAGCCAGAGCCTGG + Intronic
969619759 4:8273143-8273165 CTGCAAAGCCAGCCAGACCCAGG - Intronic
969993317 4:11286968-11286990 CAACAAAGGAAGCCAGAGCAGGG - Intergenic
970401900 4:15725222-15725244 CAGCTAGTGCAGGCAGAACCAGG + Intronic
970520267 4:16876390-16876412 GAGTTACGGCAGCTAGAGCCTGG + Intronic
977893975 4:102344424-102344446 CAGGTAAGGCCGCCAGGTCCGGG - Exonic
978045014 4:104114825-104114847 CAGCAGAGGCAGCCTAAGCCTGG + Intergenic
978549776 4:109913018-109913040 CAGTGAAGTCAGCCAGAGCAGGG + Exonic
979235775 4:118398515-118398537 CAAATCAGGCAGCCTGAGCCAGG - Intergenic
981120656 4:141047367-141047389 CAGCTGAGACAGGCAGAGGCTGG + Intronic
987756487 5:22103269-22103291 CTCCTAAGACAGACAGAGCCAGG - Intronic
989125455 5:38048478-38048500 CAGCTATGGCAGAAAGAGACTGG + Intergenic
990212328 5:53493881-53493903 CTGCCAAGGCAGCCAGAACGAGG + Intergenic
991569631 5:68040740-68040762 CAGCTCAGCCAGCCACGGCCAGG - Intergenic
997879800 5:137579427-137579449 CAGCCAAGGCGGCCAGAACTGGG - Intronic
998907341 5:146920300-146920322 CAGCAAAGACAGCCTGTGCCAGG - Intronic
999256236 5:150211339-150211361 CAGCCAAGCCGGGCAGAGCCTGG + Intronic
999389160 5:151177629-151177651 CAGCCAAGGAAGCCTGGGCCTGG - Intergenic
1002839863 6:896349-896371 CAGGTAAGGCAGCTGGAGACAGG - Intergenic
1002884748 6:1283242-1283264 GAGCTCAAGCAGCCCGAGCCTGG + Intergenic
1006093070 6:31639572-31639594 CAGCTAAGGCAGCCGGAGCTCGG - Exonic
1006105733 6:31715279-31715301 GATATAAGGCAGGCAGAGCCGGG + Intronic
1006470077 6:34223793-34223815 CAGCTAAGGCAGACAGAAGGTGG - Intergenic
1006619505 6:35353390-35353412 CAGATTAAGCACCCAGAGCCAGG + Intronic
1009827052 6:68880142-68880164 CGGATAAGGCAGCCACTGCCTGG + Intronic
1010257760 6:73778610-73778632 TAGACAAGGGAGCCAGAGCCAGG - Intronic
1010794495 6:80103710-80103732 CAGCTATGGCAACAAGATCCAGG - Intergenic
1015379426 6:132549802-132549824 CAGGTAAGGGAGGCATAGCCAGG - Intergenic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019335476 7:480647-480669 CAGCTCAGGCAGGCAGGGCAAGG + Intergenic
1019422670 7:958357-958379 CAGCTGAGGCAGGTAGAGCCAGG - Intronic
1019543005 7:1559865-1559887 CACCTCACACAGCCAGAGCCAGG - Intronic
1019910164 7:4095479-4095501 TAGCCAAGGAAGCCAGAGTCAGG - Intronic
1020136011 7:5588455-5588477 CAGCATGGTCAGCCAGAGCCCGG - Intergenic
1021510358 7:21427459-21427481 CAGCCAATGGAGACAGAGCCAGG + Intergenic
1021554755 7:21908072-21908094 CAGCAACTGCTGCCAGAGCCTGG + Intronic
1022100110 7:27164475-27164497 CAGCCAGGGCAGCCGGAGCTGGG - Intronic
1022504188 7:30900329-30900351 CAGCTAAGGCAGACACATCTTGG + Intergenic
1023770140 7:43549715-43549737 CAGCCAGGGCAGCCTGACCCTGG - Intronic
1023815060 7:43943311-43943333 CAGAGAAGGGAGCCAGAGCCTGG - Intronic
1023876013 7:44286777-44286799 CAGGTAAGACTGCCAGAGCCAGG + Intronic
1023908431 7:44537926-44537948 CAGCTGAGGGATGCAGAGCCAGG + Intronic
1027352654 7:77327474-77327496 CAGCTTAGGCTGACAGAGCCTGG - Intronic
1028217119 7:88147264-88147286 CTCCTAGGGCAGCCAGAGGCAGG + Intronic
1032191177 7:129766880-129766902 CAGGTCAGGCAGCTGGAGCCCGG - Intergenic
1032206000 7:129866048-129866070 CACCTGAGGCAGCCTGTGCCCGG + Intronic
1032784627 7:135191127-135191149 CAGCAAAGGCAGCCAGAGGATGG + Intronic
1033038128 7:137894225-137894247 CAGCTAAGGAAGCCTGAGCTTGG - Intronic
1033228896 7:139581616-139581638 CAGCTACAGCACCCAGAGCATGG - Intronic
1034866734 7:154648477-154648499 CATCTAGGGCAGCCTCAGCCAGG + Intronic
1035345191 7:158192843-158192865 AGGCTGAGGCAGCCAGAGGCCGG + Intronic
1036396923 8:8377763-8377785 CAGCAAAGGCAGCCAGTTTCTGG + Exonic
1038528645 8:28298276-28298298 CAGATAAGGCAGTAAGAGGCTGG - Intergenic
1039509718 8:38081266-38081288 CAGCAAAGGAAGCTAGAGCCAGG + Intergenic
1040466535 8:47700681-47700703 TAGGGAAGGCAGCCAGAGCTTGG - Intronic
1044371377 8:91415393-91415415 CAGCTGAGGAACCCAGAGCCAGG - Intergenic
1047374409 8:124282367-124282389 CAGGTTAGGCAGCCAGAGAGAGG + Intergenic
1047474365 8:125212413-125212435 GAGCTGAGGCAGTGAGAGCCCGG + Intronic
1048455144 8:134570940-134570962 CAGCGAAGACAGACAGAGACAGG + Intronic
1049361914 8:142215989-142216011 CTGCTGAGGCAGGCAGAGGCTGG - Intronic
1050107302 9:2178835-2178857 CAGCTTCGGCAGACAAAGCCAGG - Intronic
1052033721 9:23657143-23657165 AAACTGAGGCAGCCAGAGCCAGG - Intergenic
1052265116 9:26563050-26563072 CAGCTAAGGCATCAAAAGCATGG - Intergenic
1052736275 9:32345538-32345560 TAGCTGAGGCAACCAGAGGCTGG - Intergenic
1057481160 9:95446868-95446890 CAGCCAAGGGACCTAGAGCCAGG - Intronic
1057494921 9:95553313-95553335 CAGCTAAGGCAGAGAAACCCTGG - Intergenic
1057624768 9:96667470-96667492 CAGCCAAGGCAGCTGGAGCTGGG + Intergenic
1060809981 9:126606231-126606253 AAGGTTAGGCAGCCAGGGCCTGG + Intergenic
1060898683 9:127238290-127238312 TAGCTGTGGCAGCCACAGCCAGG - Intronic
1061166916 9:128928282-128928304 CAGCTCCTGCAGCCAGAGACAGG + Intronic
1061572011 9:131483701-131483723 CAGAAAAGGCAGCCTGAGTCTGG - Intronic
1061964355 9:134004680-134004702 CATCTGAGGCAGCCAGGGCCTGG - Intergenic
1062021574 9:134322027-134322049 CAGCCAAAGCAGCCGGTGCCAGG - Intronic
1062579567 9:137223316-137223338 CAACTGAGGCAGCCTGGGCCTGG + Intergenic
1186130554 X:6461134-6461156 CAACCAAGGAAGCTAGAGCCAGG + Intergenic
1188053004 X:25509644-25509666 CAGCAAAAGCAGCCAGGACCTGG + Intergenic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1190841556 X:54149608-54149630 CAGCCAAGGCAACAAGAGCGAGG + Intronic
1191667647 X:63719842-63719864 CAACAAAGGCAGCCACAGCCTGG - Intronic
1192179898 X:68909905-68909927 CAGCTGAGGCAGATAGACCCAGG - Intergenic
1192201769 X:69070938-69070960 AAGATGAGGCAGTCAGAGCCAGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194552623 X:95320267-95320289 AAAATAAGGCAGCAAGAGCCTGG - Intergenic
1201613068 Y:15864846-15864868 CAACAAAGGAAGCTAGAGCCAGG + Intergenic
1202369961 Y:24189672-24189694 CAGGGAAGGCAGCCAGAGAGTGG + Intergenic
1202500823 Y:25480445-25480467 CAGGGAAGGCAGCCAGAGAGTGG - Intergenic