ID: 969280534

View in Genome Browser
Species Human (GRCh38)
Location 4:6167582-6167604
Sequence TGGGGCTCCTTGTTAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969280534 Original CRISPR TGGGGCTCCTTGTTAAAAAA TGG (reversed) Intronic
901014208 1:6218484-6218506 TGGGCCTCTTTGTAAAACAAGGG + Intronic
902051107 1:13564156-13564178 TAGGGCTGCTTTTTAAGAAATGG - Intergenic
904184379 1:28691741-28691763 TGGGACTCCTTGTTCTCAAAGGG + Intronic
905127150 1:35723678-35723700 GGGAGCTCCTTGTTTAGAAAGGG + Intronic
906149809 1:43581145-43581167 TGGGGCTCCCTGTTTACACATGG + Intronic
908752112 1:67433913-67433935 AGGTGCTCCTTGTGAAGAAAAGG + Intergenic
910239959 1:85075620-85075642 CTTGGCTCCTTGTTAGAAAAAGG - Intronic
910492606 1:87789118-87789140 TGGGACTCCTTATTCAAACAGGG - Intergenic
916302322 1:163289823-163289845 GGGGGCTGCTTTTTATAAAATGG - Intronic
916575075 1:166059885-166059907 TGGGGCTGATGCTTAAAAAATGG + Intronic
917575836 1:176320994-176321016 TGGGGCCACTTTTTAAAATAAGG - Intergenic
918296674 1:183163569-183163591 TGAGACTCCTTGATACAAAAGGG + Intergenic
918307625 1:183261389-183261411 TGGGGCTCCATGTGGAAGAATGG - Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924267577 1:242298716-242298738 GGGGGCTCCTTGCTAGAATAAGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1065307245 10:24380859-24380881 TGGGGCTCCTTGTCTGCAAAAGG - Exonic
1066454218 10:35559235-35559257 AGGTGATCCTTGTTAAAAAGTGG + Intronic
1066660482 10:37734758-37734780 TGGGGCTGCTTTTTATTAAAAGG + Intergenic
1066717309 10:38300129-38300151 GGGGGCTCCTTGCTAGAATAAGG + Intergenic
1067038384 10:42935130-42935152 TTGGCCATCTTGTTAAAAAATGG - Intergenic
1068865618 10:61892526-61892548 TTGGGCACCTTTTTTAAAAAAGG + Intergenic
1070741032 10:78903470-78903492 TTGTGCTCCCTGTTAAAGAAGGG + Intergenic
1071251707 10:83825659-83825681 TGTGCCTCCTTCTTAAAAAAAGG + Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072519645 10:96219774-96219796 TGGGGCTGCTTTTTATTAAAAGG - Intronic
1075536374 10:123275431-123275453 AGGGGCTTCTTGTTACAGAAGGG + Intergenic
1077980541 11:7295377-7295399 AGGTGATCCTTGTTATAAAAAGG - Intronic
1078584572 11:12571268-12571290 TTGGGCTCCATATTGAAAAAAGG + Intergenic
1079079200 11:17402315-17402337 AGGGGCTCCTTAATAAAAGAAGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082121000 11:48379545-48379567 TGGGGCTGCTTTTTATTAAAAGG + Intergenic
1082252846 11:50001105-50001127 TGGGGCTGCTTTTTATTAAAAGG - Intergenic
1082834527 11:57641854-57641876 TAGGCCTCCTTGAGAAAAAAAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1091094340 11:132804769-132804791 TTGAGCTGCTTGTTAAAACAAGG + Intronic
1091840730 12:3618755-3618777 TGGAGCCCCTTGCTCAAAAATGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096796377 12:54080561-54080583 TTGGCCTCCTTCTTAAAACAGGG + Intergenic
1097512399 12:60560234-60560256 TGAGACTCCCTCTTAAAAAAAGG - Intergenic
1098447538 12:70581952-70581974 TTGGTTTCCTTGTTAATAAATGG - Intronic
1100810092 12:98329145-98329167 TTGGGCTCCTTTTTTAAAATTGG + Intergenic
1101246768 12:102891070-102891092 TGAGGCTCCATCTCAAAAAAAGG + Intronic
1103165327 12:118765437-118765459 TGGGCCACATTGTTAAAACACGG + Intergenic
1103758733 12:123232766-123232788 CGGGGCACCTTGGCAAAAAATGG + Intronic
1106634388 13:31511542-31511564 TGGGGATCTATGATAAAAAAGGG + Intergenic
1107128066 13:36865728-36865750 TGGGGCTCCTCGTAACAAACTGG + Exonic
1108678420 13:52758340-52758362 TGGGGCTCCTCTCTAAAGAAAGG - Intergenic
1111034788 13:82657952-82657974 GGGGTCTCCTTGGTAAAGAAGGG + Intergenic
1113358007 13:109601508-109601530 TGGAGCTCCCTCTTAAAAATGGG + Intergenic
1114845694 14:26318651-26318673 TTGGGCACATAGTTAAAAAAAGG + Intergenic
1116948864 14:50860211-50860233 AAGGGCTCCTTTTTATAAAATGG - Intronic
1117013449 14:51494012-51494034 TGGGGGTTCTTTTTAAATAAGGG + Intronic
1120007409 14:79375060-79375082 TAGTGCTCCTGATTAAAAAATGG + Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122573493 14:102725371-102725393 TGGGAGTCCTTTTTAAAAAATGG + Intronic
1123190553 14:106565386-106565408 TGGGTCTCTTTGTCAAAAACCGG - Intergenic
1124240697 15:28025477-28025499 TGGGGGTCATGGTTAAGAAATGG - Intronic
1124406513 15:29397377-29397399 TGAGACTCCATCTTAAAAAAAGG + Intronic
1126328884 15:47510726-47510748 TGGGGCTCCTTGTGGAGAAGTGG + Intronic
1126971117 15:54112699-54112721 TGGTGCTGCTTTTTATAAAAAGG + Intronic
1127186903 15:56489822-56489844 TTTGGCTCCTTTTAAAAAAATGG - Intergenic
1127927046 15:63557080-63557102 TGGGACTCCATCTCAAAAAAAGG - Intronic
1127944279 15:63734511-63734533 TGGGGCTAATTATTAAAATAAGG - Intronic
1131295111 15:91141123-91141145 AAGGGCTACTTTTTAAAAAATGG - Intronic
1131468197 15:92672647-92672669 TTGGGCTCCTTGCTGTAAAATGG + Intronic
1133307972 16:4823087-4823109 TGGGGCTTGTTTTTATAAAAAGG - Intronic
1134288022 16:12879288-12879310 TGAGACTCCTTCTCAAAAAAGGG - Intergenic
1135578257 16:23602845-23602867 TGAGGCTCCATCTCAAAAAAAGG + Intergenic
1137372717 16:47923392-47923414 TGGGCCTCCTGGTTATAAATTGG - Intergenic
1137787169 16:51149669-51149691 TTGGGGTCCCTGTAAAAAAATGG - Intronic
1138010866 16:53378659-53378681 TTGTGCTCCTTTTTAGAAAAGGG + Intergenic
1139096840 16:63714857-63714879 TGGGGCTGCTTTTTATTAAAAGG - Intergenic
1142013522 16:87730316-87730338 TGGGGTCCCTTGTTCAACAATGG + Intronic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1145119781 17:20247789-20247811 AGGGGCTACTTTTTAAATAAGGG + Intronic
1146722645 17:35133936-35133958 TTGGGTTCCTTTTTAAAATAAGG - Intronic
1148614900 17:48994860-48994882 TGGGGCTCCTCTTTAGGAAAAGG + Intergenic
1149117263 17:53112334-53112356 TGTTGCTGCTTATTAAAAAATGG - Intergenic
1150603230 17:66668685-66668707 TGGGGCCCATTTTTAAAACATGG + Intronic
1151844593 17:76643523-76643545 TGAGGCTCCTTAATAAAAGAGGG + Exonic
1155858992 18:30872496-30872518 TGAAGATGCTTGTTAAAAAATGG + Intergenic
1158619305 18:59017715-59017737 CAGGGCCCCTTGTTTAAAAATGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926187294 2:10700947-10700969 TGGGGCCCCTTGTTCAAAAATGG - Intergenic
927288690 2:21383087-21383109 TCGGGCTCCTGCTTACAAAAAGG - Intergenic
928161395 2:28929094-28929116 TGGAGCTCACTGTTAAAAATAGG + Intronic
930337584 2:50069409-50069431 TAGGCCACCTTGTTAAAACATGG + Intronic
935010091 2:99126155-99126177 TGGGGCTCCTTGTTATAGTCTGG + Intronic
939374886 2:141351656-141351678 TGGAGCTCCATGCTAAAAAGGGG - Intronic
939642995 2:144663376-144663398 TTGGTCTCCTTCTCAAAAAAAGG + Intergenic
941184931 2:162309902-162309924 AGGTGATCCTTGTTATAAAATGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942179838 2:173370095-173370117 TAAGGCTCCTTATTATAAAATGG - Intergenic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
946610682 2:221454560-221454582 TGGGGCTGTTGGTGAAAAAAAGG - Intronic
1169456045 20:5753474-5753496 TGGGGCTGCTTTTTATTAAAAGG - Intronic
1169791926 20:9420039-9420061 TGGGTCTCATTTTTTAAAAAGGG - Intronic
1172478552 20:35256923-35256945 TGGGGGTTCTTGTTATAAACGGG + Intronic
1178251295 21:31005875-31005897 TCAGTCTCCTTGATAAAAAATGG - Intergenic
1178453458 21:32726683-32726705 TCGGGCTCTTTTCTAAAAAATGG + Intronic
1178529413 21:33362683-33362705 TGGGGCTTCTTTTTATTAAAAGG + Intergenic
1179156370 21:38854474-38854496 TGGAGCACCATGTTTAAAAATGG + Intergenic
1179386470 21:40947638-40947660 TGGGGCTGCTTTTTATTAAAAGG - Intergenic
1185379009 22:50498315-50498337 TGGGGCTCCATGTCAAAAGAAGG - Intergenic
949153136 3:794389-794411 TAGGGCTCCGTGTTAATGAATGG + Intergenic
949338694 3:3005509-3005531 CGGGGATCCTTGTTAAAAAGTGG - Intronic
950538220 3:13594224-13594246 GGGGGCTGCTTGTTGAAACATGG + Intronic
951010301 3:17669584-17669606 TAGGGCTCCTTGGTAAAATAAGG + Intronic
956623307 3:71242662-71242684 TGGGGTACGTTGTTAAGAAATGG - Intronic
959845970 3:111034101-111034123 AGGGGATCCTGTTTAAAAAATGG - Intergenic
960270979 3:115674342-115674364 TGGGGCACCATGGTAAACAATGG + Intronic
961472087 3:127121716-127121738 TGGGGGTCCTTCTGACAAAAGGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963496785 3:146074033-146074055 TAGGGCTCTATATTAAAAAATGG + Intronic
965635738 3:170778471-170778493 TGGTGATCCTTGTTATAAAGTGG + Intronic
966033484 3:175379543-175379565 TGAGACTCCATCTTAAAAAAAGG - Intronic
966202981 3:177376764-177376786 TGTGCCCCCTTGATAAAAAATGG - Intergenic
967591704 3:191284331-191284353 AGAGACTCCTTCTTAAAAAAAGG - Intronic
969280534 4:6167582-6167604 TGGGGCTCCTTGTTAAAAAATGG - Intronic
970916913 4:21346690-21346712 TGGGGAATCTTGTTAAAACATGG + Intronic
971059575 4:22952708-22952730 TCGTGCTCTTTTTTAAAAAATGG + Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972613048 4:40672802-40672824 TGGGGCGCTTTGTTAACACACGG - Intergenic
972816891 4:42655737-42655759 AGGGGCTCCCTGTAAAAATAGGG - Intronic
973660416 4:53099658-53099680 TAGAGCTGCTTGTTAAAAACAGG - Intronic
974370314 4:61008483-61008505 TTACGTTCCTTGTTAAAAAATGG + Intergenic
976396976 4:84566386-84566408 TGGGGCTGCTTTTTATTAAAGGG + Intergenic
977797269 4:101181366-101181388 TGAGGATCCTTTTTAAAACAAGG + Intronic
977918669 4:102620655-102620677 TGGGGCTTCTTATGAAAGAAGGG - Intergenic
979222075 4:118238858-118238880 TGGGGCACTTTCTTAAATAAGGG + Intronic
982257434 4:153464854-153464876 TGGAGATCCTTGCTAAATAAAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
982903598 4:161039859-161039881 TGGGGCTGCTTTTTATTAAAAGG + Intergenic
984111090 4:175615236-175615258 TGGGGCTGCTTTTCAATAAAAGG + Intergenic
984507850 4:180642243-180642265 TGGAGCTCCTTGTCCAATAATGG - Intergenic
986053619 5:4113640-4113662 TGGGGCTCTGAGATAAAAAATGG + Intergenic
988415543 5:30942669-30942691 TGGGGTTCCTTTTTGTAAAATGG - Intergenic
989656894 5:43754388-43754410 AGGGGCTCATTGTTGAAAATGGG + Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
994606873 5:101979059-101979081 TGGGGATCCTTGAGAAACAAAGG - Intergenic
995426527 5:112029782-112029804 TGAGGCTCTGTCTTAAAAAAGGG - Intergenic
996475602 5:123916596-123916618 TGTAGCTGCTTTTTAAAAAAAGG + Intergenic
997200008 5:132004170-132004192 TGGGGCTCCTTCTTCAACCAAGG + Intronic
1002912662 6:1502140-1502162 TGGGGCTGCTTTCTACAAAAGGG + Intergenic
1004138658 6:12993171-12993193 TGGGGCTGCTTTTTACTAAAAGG + Intronic
1006812988 6:36832552-36832574 TAGGCCTCGTTGTTACAAAATGG - Intronic
1007712710 6:43834872-43834894 TGGGGACCCTTGTTAAGAACAGG - Intergenic
1009389271 6:63126250-63126272 TGGGGCTACTTGTTTAAGGAAGG - Intergenic
1010822975 6:80437377-80437399 TGAGGCTCTTTGCAAAAAAAAGG - Intergenic
1010985384 6:82417698-82417720 TGTGCCTCCTTGTAAAAATATGG + Intergenic
1013875520 6:114821741-114821763 TGGATCTCCTTTTTAAAAAGGGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1017953054 6:159153826-159153848 TGAGACTCCATCTTAAAAAAAGG - Intergenic
1022842869 7:34181416-34181438 AGGGGATCCTTGTTATAAAGTGG + Intergenic
1023249008 7:38237535-38237557 TGAGACTCCTTCTCAAAAAAAGG + Intergenic
1023329217 7:39096354-39096376 GGTGGCTCATTGTTAGAAAAAGG - Intronic
1025223994 7:57140984-57141006 TGGGTCTCCTACTTAAATAAAGG - Intergenic
1025745665 7:64240438-64240460 TGGGTCTCCTACTTAAATAAAGG + Intronic
1026452608 7:70542655-70542677 TGGGGCTGGTTGATAAATAAAGG - Intronic
1027748247 7:82106729-82106751 TTGAGCTCCTTCTTAAGAAAAGG + Intronic
1028679313 7:93507192-93507214 TGGGCCTCCTTGTTACATTAAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030836308 7:114291267-114291289 TGGGGTTCCTTTTATAAAAAGGG + Intronic
1031618764 7:123910808-123910830 TGTGGCTTCTTTTTATAAAAAGG + Intergenic
1031815940 7:126435390-126435412 TCGGGCACCTTTTTAAAAAAAGG - Intergenic
1034180388 7:149132934-149132956 TGGGGCTGCTTTTTATTAAAAGG + Intronic
1037203866 8:16290961-16290983 CAGGGCCCCTTGTTCAAAAAAGG + Intronic
1037391292 8:18394445-18394467 ATAGGCTCCTTTTTAAAAAATGG + Intronic
1038348317 8:26752589-26752611 TGGGGCTGCTTTTTATTAAAAGG + Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039442994 8:37608273-37608295 CTGGGTTCCATGTTAAAAAATGG + Intergenic
1039631819 8:39120837-39120859 AGGAGATCCTTGTTAAAAAGTGG + Intronic
1044931125 8:97252652-97252674 TGGGGCTCCTTTAAATAAAATGG + Intergenic
1045543338 8:103106456-103106478 TAAGTCTCCTTGTTAAAAATAGG + Intergenic
1046488452 8:114916409-114916431 TGGGGCTGCTTTTTATCAAAAGG + Intergenic
1046809758 8:118519742-118519764 TGGTTCTCCTTTTTAAAAAATGG - Intronic
1048244636 8:132780072-132780094 GGTGGCTCCTTATTTAAAAAAGG + Intronic
1050524604 9:6534585-6534607 TGGGGCACCTTGTGAAATAAGGG - Intronic
1050618619 9:7429437-7429459 AAGGGCTCCTTCTTGAAAAAAGG - Intergenic
1051350796 9:16196357-16196379 TTGTGTTCCTTGTTAAAAAGAGG + Intergenic
1053083276 9:35195258-35195280 TGGGGCTGCTTCTTATTAAAAGG + Intronic
1053356432 9:37449793-37449815 TGGGGCTGCTTTTTATTAAAAGG - Intronic
1053785985 9:41653243-41653265 TTGGCCTCCTTCTTAAAACAGGG + Intergenic
1054159066 9:61660954-61660976 TTGGCCTCCTTCTTAAAACAGGG - Intronic
1054174700 9:61867176-61867198 TTGGCCTCCTTCTTAAAACAGGG + Intergenic
1054449558 9:65396236-65396258 TTGGCCTCCTTCTTAAAACAGGG + Intergenic
1054478840 9:65591959-65591981 TTGGCCTCCTTCTTAAAACAGGG - Intergenic
1054662838 9:67713617-67713639 TTGGCCTCCTTCTTAAAACAGGG - Intergenic
1055018493 9:71644757-71644779 TAGGATTCCTTGTTAAAAACAGG - Intergenic
1055696665 9:78892287-78892309 CGGGGCTCTGTGTTACAAAAGGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1186165405 X:6821655-6821677 TGGGGCTGCTTTTTATTAAAAGG - Intergenic
1186302365 X:8214038-8214060 TGGGGCTGCTTTTTATTAAAAGG - Intergenic
1187287138 X:17916335-17916357 TTGGGCTCCATGTTTGAAAAGGG + Intergenic
1188833846 X:34932595-34932617 TGGGGCTTCTTTTTATTAAAAGG - Intergenic
1189392455 X:40587684-40587706 TGGGGTTCCTATTAAAAAAATGG - Intronic
1189565498 X:42237085-42237107 TGGGTCTGCTTATCAAAAAAGGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192278537 X:69659306-69659328 TGTAGCTCATTGTTAACAAAAGG - Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194508067 X:94758078-94758100 TGGGACTCAGTGTAAAAAAATGG - Intergenic
1195535843 X:106008503-106008525 TGTGGCTCCTTCTTAAAAACTGG + Intergenic
1198023676 X:132683753-132683775 TGGTGCTCCTTGAAATAAAATGG - Intronic
1198167023 X:134067999-134068021 AGGAGTTCCTTTTTAAAAAATGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1199575136 X:149306659-149306681 TGGGGCTTCTTGTTACCAATGGG - Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic