ID: 969282721

View in Genome Browser
Species Human (GRCh38)
Location 4:6181938-6181960
Sequence CTGTGCAGACAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 0, 2: 8, 3: 63, 4: 576}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969282711_969282721 17 Left 969282711 4:6181898-6181920 CCTGGCCTTGGGAGGATGGGTGA 0: 1
1: 0
2: 1
3: 29
4: 288
Right 969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 63
4: 576
969282710_969282721 18 Left 969282710 4:6181897-6181919 CCCTGGCCTTGGGAGGATGGGTG 0: 1
1: 0
2: 1
3: 30
4: 300
Right 969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 63
4: 576
969282714_969282721 -8 Left 969282714 4:6181923-6181945 CCCAAGGAGATGAGCCTGTGCAG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 63
4: 576
969282715_969282721 -9 Left 969282715 4:6181924-6181946 CCAAGGAGATGAGCCTGTGCAGA 0: 1
1: 0
2: 1
3: 28
4: 250
Right 969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 63
4: 576
969282707_969282721 21 Left 969282707 4:6181894-6181916 CCGCCCTGGCCTTGGGAGGATGG 0: 1
1: 0
2: 3
3: 33
4: 282
Right 969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 63
4: 576
969282706_969282721 22 Left 969282706 4:6181893-6181915 CCCGCCCTGGCCTTGGGAGGATG 0: 1
1: 0
2: 1
3: 31
4: 428
Right 969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 63
4: 576
969282712_969282721 12 Left 969282712 4:6181903-6181925 CCTTGGGAGGATGGGTGATGCCC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG 0: 1
1: 0
2: 8
3: 63
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969282721 Original CRISPR CTGTGCAGACAGGAGGAGGA GGG Intronic
900481332 1:2900883-2900905 CTGTGCAGGAAGGAGGCAGACGG - Intergenic
900525998 1:3128961-3128983 CTGTGCAGATGAGATGAGGAGGG + Intronic
900777281 1:4594578-4594600 CTGTGCAGACAACAACAGGAGGG - Intergenic
901159065 1:7161278-7161300 CTGTGCAGGGTGGAGAAGGAGGG - Intronic
901402856 1:9026227-9026249 CTGTGCAGACCTGTGGAGGGAGG - Intronic
901629295 1:10640519-10640541 CTGTGCAGACAGGCGCAGCCAGG - Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902548932 1:17208004-17208026 CTGGGCTGGCAGCAGGAGGAAGG + Intronic
902568186 1:17329209-17329231 CTGTGTATACAGGAGGCTGAGGG + Intronic
902984397 1:20146771-20146793 CTGTTCAAACATGAGGTGGAGGG + Intronic
903135860 1:21308821-21308843 CTGGGCAGGCAGGAAGGGGAGGG - Intronic
903218544 1:21856023-21856045 CTGTGCACACAGGAGCCAGAGGG + Intronic
903344420 1:22675344-22675366 ATGGGCAGGCAGGAGAAGGAAGG - Intergenic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
904073663 1:27823068-27823090 CTATGCAGACAGGTGGGAGAGGG - Exonic
904799261 1:33081370-33081392 CTCTGCTGACAGGAGGCAGAAGG - Exonic
904882260 1:33709870-33709892 CTGTGGATTCACGAGGAGGAGGG + Intronic
905474954 1:38219504-38219526 ATGTGCAGGCAGGAAGAGGAAGG + Intergenic
905518637 1:38580543-38580565 CCCAGCAGACAGGAGGAGGATGG - Intergenic
906246918 1:44282839-44282861 CTGTGCTGACCTGAAGAGGAAGG - Intronic
906692632 1:47802646-47802668 TTGTGCAGACAGAATGAGCAGGG - Intronic
907962589 1:59297067-59297089 CTAAGCGGCCAGGAGGAGGAAGG - Exonic
908316392 1:62937024-62937046 TTGTGTTGACAGTAGGAGGAAGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
909793275 1:79701558-79701580 CGGAGCAGAGAGCAGGAGGACGG + Intergenic
910345924 1:86238275-86238297 CTGTGCAAATAAGAGGAGGGAGG - Intergenic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
912082336 1:105952124-105952146 GTGTGCAGACAGGGGCAGGCAGG - Intergenic
912423628 1:109566148-109566170 CTGTTCAGAAAGAATGAGGAGGG + Intronic
912960185 1:114189209-114189231 CTTTGCTGACAGGTGGAGGGAGG + Intergenic
913483499 1:119312302-119312324 CTGTGTAGAAAGGGGTAGGATGG + Intergenic
914225318 1:145715085-145715107 CTGTTCAGAGAAGAGGAGAAAGG + Intergenic
914375569 1:147070861-147070883 GTGTCCATATAGGAGGAGGAAGG - Intergenic
914665923 1:149832499-149832521 CTGAGCAGAGTGGAGGAGGAGGG + Intergenic
914669842 1:149861295-149861317 CTGAGCAGAGTGGAGGAGGAGGG - Intronic
915624607 1:157106971-157106993 CAGTGGAGACAAGAGGAGAAGGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915944819 1:160141896-160141918 CTGGGCAGACAGGTGGGAGATGG + Exonic
916524327 1:165595176-165595198 GTTTCCAGACAGGAGGAGAATGG + Intergenic
916804265 1:168243465-168243487 CTGTGCAGCCAGCAGGAAGTAGG + Exonic
917509978 1:175661862-175661884 CTGTGGAGGCAGGAGAAAGAGGG - Intronic
917591863 1:176484164-176484186 CTATGCACATAGGAGGAGAACGG - Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
919070812 1:192752564-192752586 CTGTGCACACAGGAGAATTATGG - Intergenic
920076715 1:203342495-203342517 CTGTGGGGACAAGAGGAGCACGG + Intronic
920086412 1:203421059-203421081 CTTTGCAAACATGAGGAGAAAGG + Intergenic
920116618 1:203626358-203626380 CTATTCAGACAGGAGCAGGAAGG + Intergenic
921370468 1:214417972-214417994 TGGTGAAGACAGGAGGAGCAGGG + Intronic
921394965 1:214658919-214658941 CTGTGCAGCCAGGCGGGGGCTGG - Exonic
922042648 1:221911858-221911880 CTGTGAAGACAGGAAGATGGGGG + Intergenic
922663772 1:227451906-227451928 CTCTGCAGTCAGCAGGTGGAGGG + Intergenic
922799832 1:228360135-228360157 ATGGGCAGCCTGGAGGAGGAGGG + Intronic
922948658 1:229539133-229539155 AGGTGCAGGCAGGAGGAGGGCGG - Intronic
924032459 1:239900153-239900175 CTGTTGAGTCAGGATGAGGAAGG + Intronic
924055846 1:240123199-240123221 CTGTTCAGCCAGCAGGAGAACGG + Exonic
924866745 1:247990951-247990973 CTCTGCAGAAGGGAGGAAGAAGG + Intronic
924870530 1:248038951-248038973 CTCTGCAGAAGGGAGGAAGAAGG + Exonic
1063182645 10:3619113-3619135 CCCTGGAAACAGGAGGAGGAGGG + Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1064026633 10:11853798-11853820 GTGTGCAGTAGGGAGGAGGAAGG - Intronic
1064203305 10:13302166-13302188 CTGTGCAAACAGGAAGGGGCTGG - Intronic
1064302318 10:14133610-14133632 CTTTGCTGGCTGGAGGAGGAAGG + Intronic
1065066367 10:21969304-21969326 CTGTGAAGAGAGGATGAGGGCGG + Intronic
1065643789 10:27813811-27813833 CTGTAGAGAAAAGAGGAGGAAGG + Intronic
1065787569 10:29230383-29230405 CTGTGGAGATAGGAGGCAGAGGG - Intergenic
1065879609 10:30027509-30027531 CACTGCAGACAGGAGGATGTGGG - Exonic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066349527 10:34624648-34624670 CCCTACAGACAGGAGGATGATGG + Intronic
1066551549 10:36563852-36563874 TTAGGCAGAGAGGAGGAGGAAGG + Intergenic
1067716798 10:48696433-48696455 ATGTGGAGACACGAGCAGGAGGG - Intronic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069865755 10:71501827-71501849 CCGGCCAGCCAGGAGGAGGAGGG + Intronic
1070665375 10:78338910-78338932 CTCTGGAGACAGGCAGAGGAAGG - Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1071816998 10:89242297-89242319 CTGTGCAGAATGGAGGTGAAAGG + Intronic
1072735991 10:97880135-97880157 CTATCCAGCCAGGAGAAGGAAGG + Intronic
1072822340 10:98570278-98570300 CCATGCAGATAGCAGGAGGAAGG - Intronic
1073071753 10:100798761-100798783 CTGTCCAGACTGGGAGAGGAGGG - Intronic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1074059699 10:109953830-109953852 CAGTGCAGCCAGGAGTCGGAAGG - Exonic
1074271246 10:111955954-111955976 CTCTGTAGAGAGTAGGAGGAAGG - Intergenic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1075092149 10:119449843-119449865 TTGAGCAGGCAGGGGGAGGATGG + Intronic
1075717554 10:124565857-124565879 CAGTGGGGACAGGAGGGGGAAGG + Intronic
1075903765 10:126063636-126063658 TTCTGCAGCCAGCAGGAGGAGGG + Intronic
1076084784 10:127617689-127617711 CTGGGCAGAAAGGTGGAGAATGG + Intergenic
1076089231 10:127666436-127666458 CTTTGGAGACTGGATGAGGAAGG + Intergenic
1076096615 10:127738305-127738327 CAATCCAGAAAGGAGGAGGAAGG - Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1076695453 10:132245188-132245210 CTGTACAGCCAGGAGCAGGAGGG + Intronic
1077096409 11:800938-800960 CTGTACAGACTGGGGGAGGGGGG + Intronic
1077358047 11:2127682-2127704 CAGTGGGGACAGGAGCAGGAGGG + Intergenic
1077490822 11:2860207-2860229 CTGTGCAGAGAGCAGGATGTGGG - Intergenic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1078685153 11:13523039-13523061 TTATGCACACTGGAGGAGGAGGG - Intergenic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1081578307 11:44333678-44333700 GTGTGCCGACAGTAGGGGGACGG - Intergenic
1081730758 11:45370193-45370215 AGGGGCAGTCAGGAGGAGGAGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082891040 11:58139043-58139065 CTGGGAAGATGGGAGGAGGAAGG + Intronic
1083204794 11:61141844-61141866 AGGTGCAGCCAGGTGGAGGATGG + Intronic
1083327052 11:61878216-61878238 CTGTGGAGACAGGCGGCGGCTGG + Intronic
1083622490 11:64056069-64056091 GTATTCAGACAGGAGGAGGAAGG + Intronic
1083709474 11:64539232-64539254 CTGAGGCGACAGGAGGAGCAGGG + Intergenic
1084001959 11:66300703-66300725 CTGCACAGCCAGGAAGAGGAGGG + Intergenic
1084346090 11:68549923-68549945 CTGTGGAGACAGCAGGAGTCTGG + Intronic
1084746762 11:71175411-71175433 CTGTAAAGAGAGCAGGAGGAAGG + Intronic
1084920427 11:72465069-72465091 CAGTCCAGATTGGAGGAGGAAGG - Intergenic
1085296987 11:75436905-75436927 CCCTGCAGACAGGTGGAGGCAGG - Intronic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085850781 11:80117152-80117174 TTGAGCACAAAGGAGGAGGAGGG - Intergenic
1086911182 11:92474498-92474520 CTGGGCATACAGGAAGGGGAAGG + Intronic
1086947571 11:92858329-92858351 CTGTGCACATAGCAGGTGGATGG + Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088850413 11:113699468-113699490 CTGTGCAGACAAGGGGAGAAAGG - Intronic
1089099112 11:115945980-115946002 CTGAGCAGACAGGAGAGAGAAGG + Intergenic
1089209726 11:116791869-116791891 CTGAGAAGACAGGTGGAGGGAGG + Exonic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089784134 11:120895889-120895911 CCATGCAGAGAGGAGGAGGAAGG + Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090710186 11:129376627-129376649 CAGTGGAGACAGTAGGAGGCTGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091346423 11:134857212-134857234 CTGGCCAGAAAGCAGGAGGAGGG + Intergenic
1091394386 12:144570-144592 CTGTGCGGAAAGGAAGAGGAGGG + Intronic
1091650345 12:2304604-2304626 CTTTACAGAGAGGAGGAGGCAGG - Intronic
1091775379 12:3181560-3181582 CTGTGCAGAGGGGAGGAGATTGG + Intronic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1092913548 12:13169190-13169212 ATGTGCAGGCAGGAGGTGGCTGG + Intergenic
1094646418 12:32328870-32328892 CTGTGGAAACAGGAGATGGAGGG + Intronic
1095955345 12:47802703-47802725 CTGGGGGGACAGGAGGAGAAAGG + Intronic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1097233689 12:57526409-57526431 CTTTCCAGCCAGGATGAGGAAGG - Intronic
1097282756 12:57854903-57854925 CTGTCCAGACAGGGTGAGGGTGG + Intergenic
1097283514 12:57860483-57860505 GTGGGCAGCCAGGAGGAGAAAGG + Intergenic
1097587696 12:61534115-61534137 ATGTGCAGAGAAGAGGAGGAAGG - Intergenic
1097904376 12:64905032-64905054 GTGTGCATGCAGGAAGAGGAGGG - Intergenic
1099534620 12:83828509-83828531 CTGTGAAGAGAGGAGCAGGGAGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100245015 12:92748922-92748944 GTGTGTAGACAAGAAGAGGATGG - Intronic
1100386518 12:94109208-94109230 CTTTGCAGCGTGGAGGAGGAGGG + Intergenic
1100442745 12:94631477-94631499 ATGTGAAGACAGGAGAAAGACGG + Intronic
1100524703 12:95408413-95408435 CTGTGCTCACAGGAGCAGCATGG + Intergenic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1102101070 12:110279679-110279701 CACTGCAGGCAGGAGAAGGATGG - Intergenic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102513158 12:113429137-113429159 CTGTGCAGAAAGGAGGAAAGGGG - Intronic
1102647451 12:114413104-114413126 CTGAGCAGTCAGGAGAAAGATGG - Intergenic
1102823592 12:115927773-115927795 ATGTGCAGCCAGGATGGGGAGGG + Intergenic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103477902 12:121232236-121232258 CTGTGCAAGCAGGAGGATGCGGG - Intronic
1104373299 12:128243174-128243196 CTGGGAAGACAGGAGGATGGTGG - Intergenic
1104656282 12:130576006-130576028 CTTTGCAGTGAGGAGGAGCATGG + Intronic
1105458940 13:20566504-20566526 ATACGCAGACAGGAGGAGGTGGG + Intergenic
1105615384 13:22007472-22007494 CTGTGAAGCCAGGAGGACCATGG - Intergenic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106221454 13:27749209-27749231 CTGTGCAGCCAGAAAGCGGAAGG + Intergenic
1107996801 13:45869175-45869197 GTGTGAGGACAGGAGAAGGAAGG - Intergenic
1109298697 13:60567513-60567535 CTTTGCAAATAGGAGGAAGAAGG + Exonic
1109452671 13:62538626-62538648 CAGTGCAGAAATGATGAGGAAGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1112433269 13:99372085-99372107 CTGTGCAGGCAGGCGGTGGGAGG + Intronic
1112816775 13:103281906-103281928 CTGAGCAGGCAGGGGTAGGATGG + Intergenic
1113084686 13:106556030-106556052 CAGTGCAGATAGGAAGAAGAGGG - Intronic
1113562106 13:111289736-111289758 CTGTGAAGATAGGATGAGCAGGG + Intronic
1113890230 13:113731669-113731691 TGGTGCAGACCGGAGGAGGGAGG + Intronic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114552664 14:23542325-23542347 GGGAGCAGACAGGAGGAGAAGGG + Intronic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114633949 14:24177118-24177140 CTGTCCAGAGAGGAAGAGCAAGG - Intronic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1116950748 14:50876452-50876474 CTGAGAATACAGGAGCAGGAAGG + Intronic
1117340617 14:54788476-54788498 TGGTGCTGGCAGGAGGAGGAGGG - Intronic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1118358299 14:65034203-65034225 CTGTCCAGACTGAAGCAGGAGGG - Intronic
1119122235 14:72090371-72090393 CTGATCTGACAGGAGGTGGACGG - Intronic
1119430681 14:74566547-74566569 CTGGCCAGACAGGAGGAGAAAGG - Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120856855 14:89220088-89220110 ATGAGAAGAAAGGAGGAGGAAGG - Intronic
1120902728 14:89589920-89589942 CTGTTCAGAAAGGAGGAGTCAGG - Intronic
1120905934 14:89621281-89621303 TTTGGCAGAGAGGAGGAGGAAGG - Intergenic
1121144716 14:91574003-91574025 CTGGGCAGGGAGGAGGAGGTTGG + Intergenic
1121522351 14:94594735-94594757 ATGTGCAGACAGGGGGGTGAGGG - Intronic
1122355407 14:101120257-101120279 CAGAACAGACAGGAGGAGCATGG + Intergenic
1122612358 14:102994241-102994263 CTGAGAAGACAGGCCGAGGAGGG + Intronic
1122820678 14:104343291-104343313 CCCTGCAGACAGGAGCAGGAGGG - Intergenic
1122969791 14:105147889-105147911 CTGTAAGGAGAGGAGGAGGAGGG + Intronic
1123033456 14:105461930-105461952 ATGTTCAGACAAGAGGACGAGGG + Intronic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1124363881 15:29058111-29058133 CTGTACCGAAAGGAGGTGGAGGG - Intronic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125297726 15:38221177-38221199 ATCTGCAGTGAGGAGGAGGAAGG - Intergenic
1125589015 15:40843477-40843499 CTGTACATACAAGATGAGGAGGG + Intergenic
1125904439 15:43377662-43377684 CGCTGCAGATAGGAAGAGGATGG - Intronic
1126034041 15:44530969-44530991 CTGGCCAGACAGGAATAGGAAGG + Intergenic
1127205742 15:56716389-56716411 CTAGGCAAACAGGAGAAGGAAGG + Intronic
1127968513 15:63941769-63941791 CTGTACAGAAAGGAGCATGAGGG + Intronic
1128769147 15:70268847-70268869 CTCGGCAGGCATGAGGAGGAGGG + Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129169535 15:73799196-73799218 CTGCTCAGAGAGGAGGAGCAAGG + Intergenic
1129239245 15:74241923-74241945 TGGGGCAGACAGCAGGAGGAGGG + Intronic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1130416674 15:83701073-83701095 CTCTGCAAACAGGAGAAGCAGGG - Intronic
1130520309 15:84656840-84656862 CTGTGTAGACTGGGGGAGAAAGG + Intronic
1130635969 15:85620283-85620305 CTGTGCACAGTGGAGGATGAGGG + Intronic
1130910923 15:88270286-88270308 CAGTGCAGAGATGGGGAGGAGGG + Intergenic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131406803 15:92171763-92171785 CTGTGCCTAAAGGGGGAGGAGGG - Intronic
1132602301 16:778763-778785 CTGGGCAGAGAGGAGGAGACAGG + Intronic
1134127998 16:11629618-11629640 GTGTGCAGCCAAGAAGAGGAAGG - Intronic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135112289 16:19699627-19699649 CTGTGCAGACACCAGGACCATGG + Exonic
1135728773 16:24877235-24877257 CTGTGAAGAAAGGAGGTTGATGG - Intronic
1136013346 16:27379143-27379165 CTGCACACACAGGCGGAGGATGG - Intergenic
1136043447 16:27598356-27598378 ATGTGCAGACAGGAGAGAGACGG - Intronic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136403045 16:30028853-30028875 GTGTGCAGGCAGGAGGCGGGGGG - Intronic
1136729986 16:32401395-32401417 CAGTGCCGACAGGAGTGGGATGG + Intergenic
1136922739 16:34345578-34345600 CTGAGCAGACAGGAGTAGGAGGG + Intergenic
1136981834 16:35066228-35066250 CTGAGCAGACAGGAGTAGGAGGG - Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1138066553 16:53947260-53947282 CTTTGCAGGCAGGAAGAGGCAGG + Intronic
1138090045 16:54166458-54166480 CTGTGCAGAAAAGTGAAGGAAGG + Intergenic
1138211375 16:55166057-55166079 CTATGCAGACAGCTGGGGGAAGG - Intergenic
1138345929 16:56320211-56320233 TTGGGCACACGGGAGGAGGATGG - Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1139410000 16:66751497-66751519 CTGACCAGTGAGGAGGAGGAAGG - Exonic
1139484913 16:67249947-67249969 CTGCTCAGAAGGGAGGAGGAAGG - Intronic
1139782360 16:69362337-69362359 CACTGCAGGCAGGAGGAGAAAGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140031210 16:71340696-71340718 CTGAGCAGACAGGAGGTGGGAGG - Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140479221 16:75253475-75253497 CGGTGCAGAGAGGAGGTGGATGG + Intronic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141461167 16:84179588-84179610 CTGTCCACACAGGAGGAGCCAGG + Exonic
1141643980 16:85357601-85357623 CAGAGCAGCCGGGAGGAGGACGG + Exonic
1141870063 16:86779152-86779174 CTGTGCAGCCAGGGTGAGGTGGG - Intergenic
1141912697 16:87070837-87070859 CTGTGCACACAGGGAGAGGCTGG + Intergenic
1142123950 16:88400960-88400982 TTCTGCAGACCGGAGGGGGATGG + Intergenic
1142171167 16:88623599-88623621 CTCCGCAGACAGGCCGAGGAAGG + Intronic
1142814585 17:2415202-2415224 TTGTGCACATAGGAGGAGAAGGG - Intronic
1143586476 17:7853172-7853194 CAGTGCAGTCAGGGGGAGGGAGG - Intronic
1143973818 17:10815378-10815400 CTGCTCAGTCTGGAGGAGGAAGG - Intergenic
1143980598 17:10866168-10866190 CTGTGCAGAAAGGAGGGAGGAGG + Intergenic
1144059521 17:11570171-11570193 TGGTGAACACAGGAGGAGGAAGG + Intergenic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1144523615 17:15971143-15971165 CTGTGAACAAAGGAGGAGTAAGG + Intronic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1144702323 17:17347751-17347773 CATTGAAGACAGGCGGAGGAAGG + Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144772045 17:17765325-17765347 CAGTCCAGGCAGGAGGTGGAGGG + Intronic
1145010556 17:19365322-19365344 CTGTGGAGAGAGGAGGTGAAGGG + Intronic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146650889 17:34605553-34605575 CTTTGCCTACAGGCGGAGGAAGG + Intronic
1146789997 17:35745743-35745765 CTGGGCCTACAGGAGCAGGAGGG - Exonic
1146926788 17:36751029-36751051 CTACGGTGACAGGAGGAGGAAGG + Intergenic
1147143099 17:38470014-38470036 GGGTGCAGGGAGGAGGAGGAAGG - Intronic
1148742133 17:49898822-49898844 CTGTGCACACAGAAGAGGGATGG - Intergenic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149513942 17:57265841-57265863 CTTTGGAGACATGAGGATGATGG + Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1151188094 17:72378709-72378731 GTGTGCAGGCAGGGGGAGGGCGG + Intergenic
1151322177 17:73358825-73358847 CTGTGCTGCTAGGAGGAGGGAGG + Intronic
1151516435 17:74599146-74599168 ATGTGCAGAGATGGGGAGGAAGG + Intergenic
1151989836 17:77567260-77567282 CTTTGCATGCAGGAGGAGGCTGG - Intergenic
1152382066 17:79947229-79947251 GAGTGCAGACAGGAAGAGGAGGG - Intronic
1152405335 17:80095111-80095133 CTGTGCCGCCAGGAGGAACAAGG - Intronic
1152761152 17:82107622-82107644 CTGTTGTGACAGGAGAAGGAGGG + Intronic
1153829869 18:8912648-8912670 CCGGGCTGCCAGGAGGAGGAGGG - Intergenic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1155112476 18:22729673-22729695 CTAGGCAGAAAGAAGGAGGAAGG - Intergenic
1158318534 18:56238134-56238156 ATGAGCAGACTGGAGGATGATGG + Intergenic
1158665970 18:59433109-59433131 TTTTGCAGAGAGAAGGAGGAAGG + Exonic
1160233632 18:77068067-77068089 CTGGGCAGACAGGAGGGGATGGG + Intronic
1161156765 19:2735868-2735890 GTGTCCAGAAAGGAGGAGAAGGG - Intronic
1162144887 19:8607524-8607546 TTTTGCACAGAGGAGGAGGAGGG - Intronic
1162145308 19:8609537-8609559 ATGTGCAGCCGGGAGGAGGCCGG - Intronic
1162234082 19:9292179-9292201 ATATGCAGAGGGGAGGAGGAAGG - Intergenic
1162270229 19:9608338-9608360 CTGTGAAGACATGAGGAAGTGGG + Exonic
1162462283 19:10820286-10820308 CTGGGCAGAGATGAGGATGAAGG + Intronic
1163130723 19:15271173-15271195 AGGTGAAGACAGGAGAAGGAAGG - Intronic
1163388552 19:17015509-17015531 CAGAGCAGACAGGAGGTGGGTGG - Intronic
1163497021 19:17652535-17652557 CAGCCCAGAGAGGAGGAGGAGGG - Intronic
1163625288 19:18386068-18386090 CTCTGCAGGCAGGGGGAGGAGGG + Intronic
1163775619 19:19215586-19215608 GTGTGAAGTCAGGAGGAGGATGG + Intronic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165928812 19:39343031-39343053 TTCTGGAGACAGGAGGAGGACGG - Intronic
1167012221 19:46816186-46816208 CTGAGCACACAGGAGGTGGTCGG + Intergenic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1168064580 19:53911745-53911767 CTGAGCCGCCAGGCGGAGGATGG + Intronic
1168146256 19:54421259-54421281 CAGTGCTGAGCGGAGGAGGAGGG - Exonic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168397364 19:56059995-56060017 AGGTGAAGACAGGATGAGGAAGG + Intronic
925018957 2:553650-553672 CTGTCCACCCAGGAGGAGGTGGG + Intergenic
925018979 2:553711-553733 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925018993 2:553742-553764 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925019004 2:553772-553794 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925065081 2:923151-923173 CCGAACAGAAAGGAGGAGGAAGG - Intergenic
925265598 2:2564359-2564381 CTTTGCAGACAGGCGGGGGCGGG + Intergenic
925286526 2:2719841-2719863 CGCTGGAGACATGAGGAGGAAGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926241790 2:11094337-11094359 GTGAGCAGAAAGGGGGAGGACGG - Intergenic
926289028 2:11514038-11514060 CAGTGCAGAGAGGATGGGGATGG + Intergenic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
927871795 2:26628726-26628748 CTGAGAAGACAGGAGGAGCAGGG - Intronic
927960528 2:27238283-27238305 GTCTGGAGACAGCAGGAGGAGGG + Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928613731 2:33016181-33016203 CTGTGCAGAGACAAGGAGGTGGG + Intronic
929214828 2:39401200-39401222 CTATACAGACAGGAAGGGGAGGG + Intronic
929936778 2:46298896-46298918 GGGTGGAGACAGGAGGAGAAAGG - Intronic
930723437 2:54659498-54659520 GTGTGCACACAGGATGAGAAAGG - Intronic
930880352 2:56263468-56263490 CTGAGCAGACAGGCAGAGAAGGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931732425 2:65165132-65165154 CAGAGCAGAAAGGAGGAGCAAGG - Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
931910122 2:66889917-66889939 CTGGGCAGAGAGGAGAAAGAAGG - Intergenic
932605977 2:73166018-73166040 CTGTTCAGATAGGAGGCTGAGGG - Intergenic
933926448 2:87094432-87094454 CTGTTCAGATAGGAGGCTGAGGG + Intergenic
934163788 2:89275927-89275949 GAGTGCAGAGAGGAGGAGGCAGG - Intergenic
934203484 2:89906597-89906619 GAGTGCAGAGAGGAGGAGGCAGG + Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934716563 2:96548085-96548107 CTGTGCAGACCTCAGAAGGAAGG - Intronic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936559814 2:113527481-113527503 CCGTGCAGACAGGAGCAGAGGGG + Intergenic
936775918 2:115972997-115973019 CTATTCTGACAGGAGGTGGATGG + Intergenic
937122002 2:119446931-119446953 GTGTGCCTACAGGAGGAGAAAGG - Intronic
937307194 2:120879525-120879547 ATGAGCAGTTAGGAGGAGGATGG + Intronic
937701053 2:124863375-124863397 TTGTGCAGACAGGAGCTGGTAGG - Intronic
938089916 2:128424751-128424773 CTGTCAAGTCAGGAGGGGGATGG - Intergenic
938392709 2:130917533-130917555 CTCTGCAGGCAAGAGAAGGAGGG + Intronic
938580798 2:132645078-132645100 CTGGGCAGACACGAGCAGGAGGG - Exonic
939219167 2:139280216-139280238 CTGTGAAGACAGGGAGAGGATGG + Intergenic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
940426437 2:153536385-153536407 CTGTCCAATCTGGAGGAGGAGGG + Intergenic
940864519 2:158804597-158804619 GGATGCAGACAGGAGGAGAATGG - Intronic
941941332 2:171041519-171041541 CTGGTCTGACAGGAGGTGGATGG - Intronic
941975809 2:171403956-171403978 CCCTGCAGACAGGATGAGGAGGG - Intronic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
946044365 2:216809505-216809527 CTCAGGAGACAGGAGCAGGAGGG + Intergenic
946166196 2:217865432-217865454 ATGTGCAGACAGAGAGAGGAAGG + Intronic
947201054 2:227614942-227614964 CTCTGGAGACAGGAGAGGGAAGG + Intronic
947835538 2:233172212-233172234 CTGTGCAGGCTGGTGAAGGATGG + Intronic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
948059102 2:235030627-235030649 CTGAGCTGGGAGGAGGAGGAGGG + Intronic
948593961 2:239067785-239067807 CTGTGCCGACAGGAGTGGGGAGG + Intronic
948691946 2:239711680-239711702 CTGAGGAGAAAAGAGGAGGATGG - Intergenic
948707562 2:239804574-239804596 CTGTGCTGACGGGCAGAGGATGG + Intergenic
948768683 2:240236365-240236387 AGGTGCAAACAGGAGGACGATGG - Intergenic
948793318 2:240390217-240390239 CGGTGCAGAATGGAGAAGGAGGG - Intergenic
948870132 2:240793548-240793570 GTGAGGAGAGAGGAGGAGGACGG + Intronic
948995504 2:241576253-241576275 GGCTGCAGACAGGAGGAGGAAGG - Intergenic
949018800 2:241728850-241728872 CTGTGCAGACTGGTGGCGGTGGG + Exonic
949075277 2:242053377-242053399 CTGTGAAGACAGGAGGTGTTTGG + Intergenic
1168861292 20:1047827-1047849 CTGTGCAGAGATGAGTTGGAAGG + Intergenic
1170995685 20:21355219-21355241 CTGGGGAGAAAGGAGGAGTAGGG - Intronic
1171442460 20:25176382-25176404 GTGTGAAGCCAGGAAGAGGAGGG + Intergenic
1171487986 20:25497707-25497729 CTGGGCTGTCAGCAGGAGGAAGG - Intronic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1172084303 20:32367681-32367703 CAGTGCAGACAGCAGCATGATGG - Intronic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172656293 20:36540862-36540884 TTGGGCAGACAGGAGGTGCAGGG - Intergenic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1173664291 20:44753913-44753935 CTGTGCAGACACCAGGGGAAGGG + Intronic
1174402766 20:50284825-50284847 CTGTGCAGGCAGCAGGAAGCTGG - Intergenic
1174591441 20:51648393-51648415 ATGTGCAGAGAGAAGGTGGAAGG + Intronic
1174872602 20:54197135-54197157 CTGCGAAGACATGAGGAGGAGGG - Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175840270 20:62022160-62022182 CTGTGCAGTCAGGAGGTGGGTGG + Intronic
1175906572 20:62382809-62382831 CTGTACAGACAGCGGGTGGAGGG + Intergenic
1176047643 20:63101064-63101086 CCGTGCAGGCAGCAGCAGGAAGG - Intergenic
1176244703 20:64091899-64091921 CTATGCAGGCTGGAGGAGGTGGG - Intronic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1178717593 21:34980403-34980425 CTGTGAAGATAGGAGGAGCTGGG + Intronic
1179488921 21:41727919-41727941 CAGCGCAGACAGGAAGAGCACGG + Intergenic
1179639721 21:42739251-42739273 GTCTGCAGACAGCAGCAGGACGG - Intronic
1179660143 21:42869078-42869100 ATCTGCAGAGAGGAGGAGGAGGG + Intronic
1179805385 21:43834102-43834124 CTTGGCAGACAGGGAGAGGAGGG + Intergenic
1179937077 21:44612791-44612813 CTGGGCTGGCAGGAGGAGGCAGG - Exonic
1180024816 21:45155012-45155034 CTATTCAGACAGCAGGAGGGTGG - Intronic
1180107438 21:45629423-45629445 CTGTGCACACAGGAGCCGGGAGG + Intergenic
1180125973 21:45790552-45790574 CTGTGGAGAGAAGAGGAGCAAGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180746013 22:18089520-18089542 CTGTGCTGTCAGGATGAAGAAGG + Exonic
1182847467 22:33443412-33443434 CAGTGCAGACAGGAGCAGGTGGG - Intronic
1183439949 22:37817537-37817559 CTGCCCAGATAGGAGGAGGCTGG + Intergenic
1183778509 22:39983676-39983698 TTGTGCAGCCAGCAGGAGCAGGG - Intergenic
1184516385 22:44965297-44965319 CTGTGCAGAGGGGAAGAGGCTGG - Intronic
1184792998 22:46712641-46712663 GTGTGCAGACAGCAGGAAGAAGG + Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185066280 22:48633143-48633165 CTGGGCAGCAAGGAGGAGGCTGG + Intronic
1185128870 22:49026121-49026143 CTTTCCAGTCAGGAGGAAGAGGG - Intergenic
1185130235 22:49034883-49034905 CTGTGCATAGAGGAACAGGATGG + Intergenic
1185249223 22:49791011-49791033 CAGTGCAGTCAGGAGGAGCAGGG - Intronic
1185348281 22:50320099-50320121 CTGGGCAGATGGGATGAGGAGGG - Intronic
949435432 3:4024248-4024270 CTGTGTAGACAGGAGTACAAAGG - Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
953992499 3:47495214-47495236 CTGTGAAGACTGCAGGAGGTGGG - Intergenic
954595936 3:51824730-51824752 CTGTGCGTTAAGGAGGAGGATGG - Intronic
954713334 3:52515534-52515556 CTGTCCAGAGAGAAGGAGGTGGG + Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955696337 3:61641195-61641217 ATCTGGAGAGAGGAGGAGGAAGG - Intronic
955867657 3:63402107-63402129 CCCTGCAGCCAGAAGGAGGAAGG + Intronic
956917751 3:73891033-73891055 CTGTGCAGACAGGAGATGGGAGG - Intergenic
958630548 3:96677234-96677256 CGCTGAGGACAGGAGGAGGAGGG + Intergenic
958765083 3:98358166-98358188 TTGTCCAGACTGGAGCAGGAGGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959702675 3:109312779-109312801 CTGAGAAGACAGTAGGTGGATGG + Intronic
959979588 3:112500824-112500846 CTGTGAACACAGGAAAAGGAAGG - Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961096427 3:124160412-124160434 CTGTGCAGAGAGAAGGGTGATGG + Intronic
961613081 3:128156023-128156045 CAGTCCAGACTGGAGGTGGAAGG + Intronic
961831063 3:129623290-129623312 CTGTGAAGACAGGAGGGAGAAGG + Intergenic
962574641 3:136745592-136745614 CTGATCTGACAGGAGGTGGATGG + Intronic
962628685 3:137253276-137253298 CTTTGCAGCCAGGAGGAAGTGGG + Intergenic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
962857153 3:139357957-139357979 CTCTGCAGACAAAAGGAAGAGGG + Exonic
962956368 3:140270606-140270628 GTGTGTAGACAGGAGGATGGGGG + Intronic
963249898 3:143093686-143093708 CTGAGCGGAGAGGAGGAGGCTGG + Intergenic
964541331 3:157783018-157783040 CTGTGCAGAGTGGAGGGGGTGGG - Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
966523856 3:180900264-180900286 CTTTCCACACAGGAAGAGGAGGG - Intronic
966879463 3:184341853-184341875 ATGTGCAAACGGGAGGAGAAAGG - Intronic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
968351006 3:198051868-198051890 CTTTGAAGACAGGAAGATGAGGG - Intergenic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969890886 4:10258995-10259017 GTGGGCAGACAGGTGGAGGCTGG + Intergenic
969903241 4:10369442-10369464 ATGTGAAGATAGGAGGAGGAGGG + Intergenic
970424855 4:15936582-15936604 CTGAGCAGCCAGTAGGAGGAAGG + Exonic
971141764 4:23932327-23932349 CCCTGGAGGCAGGAGGAGGATGG - Intergenic
971349465 4:25843334-25843356 GAGTCCAGACAGGAGGATGACGG + Intronic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
972772051 4:42206555-42206577 GTCTGCAGACAGCAGGAGCATGG + Intergenic
973635313 4:52856993-52857015 CTGTGCAAACAGGATGTGGGAGG + Intergenic
975470198 4:74757085-74757107 CTGTGGAGCCAGGAGGACCATGG + Intronic
976383012 4:84421644-84421666 CTCTTCAGACAGAAGGAGGGAGG - Intergenic
978338259 4:107693216-107693238 CTGTGAAAACAGGAACAGGAGGG + Intronic
979827055 4:125250894-125250916 CTGTGCAGATAGGAGGGAGGGGG - Intergenic
981285199 4:143009566-143009588 CTCAGAAGACAGGAGGATGAGGG - Intergenic
982064861 4:151645208-151645230 CCATGGAGACAGTAGGAGGAGGG + Intronic
984432506 4:179666434-179666456 GTTTCCACACAGGAGGAGGAGGG - Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985815290 5:2124033-2124055 GTCTCCAGCCAGGAGGAGGAAGG + Intergenic
986251001 5:6058595-6058617 TTGGGCAGACAGGAGGCGGAAGG - Intergenic
986689976 5:10306362-10306384 GGGGGCAGAGAGGAGGAGGAGGG + Intronic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
986806535 5:11313228-11313250 CTGCTCAGGGAGGAGGAGGAGGG - Intronic
987382860 5:17302070-17302092 CTGTACAGACTGGGGGAGGGTGG + Intergenic
987466834 5:18282061-18282083 CTCTCCAGACAGAAGGAGGAGGG - Intergenic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
988491809 5:31711544-31711566 CAGTGCAGAGAGGTGGAGGGAGG + Intronic
989210434 5:38853926-38853948 CTGTGGAGCCTTGAGGAGGAAGG + Intronic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
992039231 5:72812940-72812962 CTTTGCTGACATGAGTAGGATGG + Intergenic
992181994 5:74206596-74206618 CTGTGAACAGAGGAGGAGGGAGG - Intergenic
992582737 5:78198445-78198467 CTGTCCACACACCAGGAGGAGGG - Intronic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
994285070 5:97955108-97955130 CTCAGAAGACAGGAGGATGAGGG + Intergenic
995629681 5:114119624-114119646 GTGATCAGACAGGAGGAAGACGG - Intergenic
997267535 5:132503950-132503972 CTGGGGAGACTGGAGTAGGAGGG + Intergenic
997370259 5:133355174-133355196 CTGTGCAGCCTGGCTGAGGAAGG + Intronic
997398133 5:133580900-133580922 CTGTGCAGATTGAAGGAGGCGGG - Intronic
997428291 5:133819384-133819406 CTGAGCAGAGTGGAGGAGCAGGG - Intergenic
997882921 5:137606301-137606323 CACTGCAGTCAGGAGGAGGATGG + Intergenic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998388049 5:141769512-141769534 CTCTGCAGAAAGGAGGAGAGAGG - Intergenic
998796565 5:145825998-145826020 CTGGGAAGACAGGAGGCAGATGG + Intronic
999206364 5:149851099-149851121 CTTTGCGGGCAGGAGAAGGAAGG + Exonic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999445170 5:151633214-151633236 CTGTACCGAAAGGAGGACGAAGG + Intergenic
999452243 5:151687009-151687031 AGGAGGAGACAGGAGGAGGAGGG - Exonic
999622877 5:153490410-153490432 GTGTGCAGAAAGGTGGAGGTGGG - Intronic
1000736947 5:164915413-164915435 TTGGGCAGAGAGTAGGAGGAAGG + Intergenic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1002096469 5:176834257-176834279 CTGTGCAGACAGGACAGGGACGG - Intronic
1002293066 5:178212754-178212776 CTGGGCTGTCAGGAGGTGGAAGG - Intronic
1002299968 5:178252469-178252491 CAGAGCAGACAGGAAGAGGGAGG + Intronic
1002567619 5:180120533-180120555 CTCTGCTGCAAGGAGGAGGACGG + Intronic
1003409339 6:5849538-5849560 CTCAGCAGGCAGGAGGTGGAAGG + Intergenic
1003879381 6:10466339-10466361 ATTTGAAGGCAGGAGGAGGAGGG + Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005177705 6:23065866-23065888 CTCTGCAGTCAGGTGCAGGATGG + Intergenic
1006080782 6:31565022-31565044 CTGTGAAGACAGGAAAAGCATGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006642060 6:35494666-35494688 CTGGGCGGGGAGGAGGAGGAGGG + Intronic
1006731135 6:36236916-36236938 CTAGGCAGAAAGGAAGAGGAAGG - Intergenic
1007221823 6:40284687-40284709 CAGAGCAGAAAGGAGAAGGAAGG - Intergenic
1007222759 6:40292118-40292140 GTGTGGAGGCAGGAGAAGGAAGG + Intergenic
1007278445 6:40692671-40692693 CTGTGCACACAGGGAGAGGGAGG + Intergenic
1007345708 6:41228236-41228258 CTCTGCAGACCAGGGGAGGAGGG - Intergenic
1008420322 6:51291701-51291723 ATGTGGAGACAGGAGGGGGATGG + Intergenic
1010669736 6:78674000-78674022 CTCTGCAGCCAGGAGGAGCCTGG - Intergenic
1011517355 6:88167344-88167366 CCGTGCACACAGGAGGCAGACGG - Intergenic
1011556097 6:88572821-88572843 TTGAGCAGACAAGAAGAGGAGGG + Intergenic
1012142091 6:95636765-95636787 CAGAGCAGACAAGAGGAGCAGGG + Intergenic
1012378517 6:98591142-98591164 TTGTGCAGACACGAGCAGCATGG + Intergenic
1014258116 6:119184572-119184594 CTGAGGAGGCAGGAGTAGGAAGG + Intronic
1014268976 6:119314655-119314677 CTGTGCATGGAGGAGCAGGAGGG - Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016295127 6:142565629-142565651 CAAAGCAGACAGGAGGAGTAAGG + Intergenic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1016479526 6:144467226-144467248 ATGAGCAGACAGGAGGAGGAGGG - Intronic
1016959196 6:149655360-149655382 GTGAGCAGAGAGGAGGAGAAGGG - Intergenic
1017668635 6:156747762-156747784 CTTTGCAATAAGGAGGAGGATGG + Intergenic
1017763909 6:157591982-157592004 CTGTGCAGTCAAGAACAGGAGGG - Intronic
1018728286 6:166630111-166630133 CTGGACAGACAAGAGGAGGCGGG + Intronic
1018890023 6:167976663-167976685 CTGTGCGGGGAGGAGGAGGCAGG + Intergenic
1019079384 6:169419817-169419839 CTGTGCGGGGAGGAGGAGGTGGG + Intergenic
1019102250 6:169641008-169641030 CTGTGCTGGTAGGAGGAGGTGGG - Intronic
1019201825 6:170322864-170322886 GTTTGGAGAGAGGAGGAGGAGGG + Intronic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019648796 7:2145107-2145129 CTGTGGAGCCAGGAGCAGGCAGG - Intronic
1021841886 7:24727707-24727729 CTCTGTAGACTGGAGGAGGTTGG - Intronic
1021968005 7:25941087-25941109 TTGTTCAGAAAGGAAGAGGAAGG + Intergenic
1022478470 7:30727432-30727454 CTCTGGAGGCAGGAGGAGGGAGG + Intronic
1022942007 7:35250086-35250108 GTGCACAGAGAGGAGGAGGACGG + Exonic
1023579886 7:41670508-41670530 TGCTGCAGACTGGAGGAGGAAGG + Intergenic
1023682985 7:42706788-42706810 CGCTACAGACAGGAAGAGGAGGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023979271 7:45057615-45057637 ATGAGCAGATAGGAAGAGGATGG + Intronic
1024131030 7:46353541-46353563 CTATGCAGACATGAGAAGGAAGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1025227562 7:57178176-57178198 CAGTGCAGCCAGGAGCAGGCAGG - Intergenic
1025730313 7:64102136-64102158 CAGTGCAGCCAGGAGCAGGCAGG + Intronic
1026299710 7:69086671-69086693 CTGTGAAGACAGGATGCAGAAGG + Intergenic
1026913613 7:74106923-74106945 GCATGCAGGCAGGAGGAGGAAGG + Intronic
1026941176 7:74289022-74289044 CTGGACAGAAAGGATGAGGAGGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027140168 7:75651098-75651120 CTGCCCACACAGGAGGAGGGAGG + Intronic
1028251768 7:88545944-88545966 TTCTGCAGACAGGAGGAAAATGG - Intergenic
1029440321 7:100583680-100583702 CTGGGCAGAGAGGAAGAGAAAGG - Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1030401447 7:109056345-109056367 CAGTGCAGAAAGGATGAAGATGG - Intergenic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033210780 7:139458738-139458760 CTTTGCAGAGTGGAGGAGGGAGG - Intronic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1034892968 7:154856851-154856873 CTGTGCACACAGGATGGGGCTGG + Intronic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035529321 8:338345-338367 CTGTGAAAACATGAGGAGTAGGG + Intergenic
1035754944 8:2023910-2023932 CTCTGCAGGGAGGAGGAGGGAGG + Intergenic
1036001316 8:4608121-4608143 GTGTGAAGACAGGAAGAGGGAGG + Intronic
1036076958 8:5512796-5512818 CTGGGGTGACAGGAGGTGGAAGG + Intergenic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036966224 8:13301097-13301119 CTGTGGATACAGGAGGATAATGG + Intronic
1037753875 8:21699260-21699282 AGGAGCAGACAGGAGGAGGGAGG + Intronic
1037909542 8:22735704-22735726 CTGTCAAGAGAGGAGGAGGGTGG + Intronic
1037948528 8:23004294-23004316 CGGAGCTGACAGGAGGAGGAAGG - Intronic
1038083400 8:24165585-24165607 CAGTGCAGGCAGGAGAAGGCAGG - Intergenic
1038280180 8:26156905-26156927 CTGTGCAGCCAGAAGCAAGATGG + Intergenic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1038433038 8:27515100-27515122 GTTTCCACACAGGAGGAGGAGGG - Intronic
1038488210 8:27951281-27951303 CTGTGCTGAGTGGAGCAGGAGGG + Intronic
1038745889 8:30254387-30254409 CTGATCTGACAGGAGGTGGATGG + Intergenic
1039177013 8:34820148-34820170 CTTTGGAGAGGGGAGGAGGAAGG + Intergenic
1039418305 8:37414602-37414624 GGGTGCAGACTAGAGGAGGAGGG - Intergenic
1039431212 8:37526524-37526546 CTATGCGGAGAGGAAGAGGAAGG + Intergenic
1039662045 8:39478382-39478404 CTCTGCAGAAAGGAAGAGGGAGG - Intergenic
1039794824 8:40903883-40903905 CTGGGCAGACAGGAGTAGTGAGG - Intergenic
1040533261 8:48283111-48283133 CTGTGCTGACTAGGGGAGGAGGG + Intergenic
1040694505 8:49979533-49979555 GTGTGCAGACAGGCAGAGGAAGG - Intronic
1040873029 8:52120539-52120561 CTGAGCATCCAAGAGGAGGAAGG + Intronic
1041731915 8:61070995-61071017 TTCTGTAGACAGGAGCAGGAAGG - Intronic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042791722 8:72615105-72615127 CTGTCCAGAAAGCAGGAGCATGG + Intronic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1042923895 8:73947341-73947363 GTGTGAAGACAGGAAGAAGATGG + Intronic
1043559397 8:81472996-81473018 CTGTGAAGACAGGAGGTCAAGGG + Intergenic
1044431231 8:92109629-92109651 CTCTGCATATAGAAGGAGGATGG - Intergenic
1046301143 8:112292537-112292559 CTTTGCACATAGGTGGAGGATGG + Exonic
1047785467 8:128150130-128150152 CTGTTCAGACAGGCGGAGACGGG + Intergenic
1048949239 8:139480478-139480500 CTGAGGAGACGGGAGGAGCAGGG + Intergenic
1049418694 8:142507286-142507308 CTGTGGAGCCAGGAGGACGGAGG + Intronic
1049435818 8:142585756-142585778 CTGTGGAGACGGGTGCAGGAGGG - Intergenic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049743964 8:144255242-144255264 CTCCTCAGAAAGGAGGAGGAGGG - Intronic
1049822124 8:144641831-144641853 CAGTGCAGCCACGAGGAGGAGGG + Intergenic
1049893054 9:88891-88913 CCGTGCAGACAGGAGCAGAGGGG - Intergenic
1049910457 9:261144-261166 CCTGGCAGACAGGAGTAGGAGGG + Intronic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1052844396 9:33322334-33322356 CTGAGCTGAGGGGAGGAGGAAGG - Intronic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053734272 9:41088944-41088966 CCGTGCAGACAGGAGCAGAGGGG - Intergenic
1054694122 9:68342628-68342650 CCGTGCAGACAGGAGCAGAGGGG + Intronic
1055509764 9:76984601-76984623 CTGGGCAGTCTGGATGAGGAGGG - Intergenic
1056311811 9:85348535-85348557 CTCTGCATAAATGAGGAGGATGG - Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1060260728 9:122071523-122071545 CTCAGCAGAAAGGAGGAGGGTGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061105267 9:128525290-128525312 CTGCGAAGACAAGAGGAGGCAGG + Exonic
1061364881 9:130167343-130167365 CTGTGCAGATTGGAGCAGGCAGG - Intergenic
1061533770 9:131235040-131235062 CTGTGCAGTTAGGAGAGGGAGGG + Intergenic
1061609699 9:131738572-131738594 CTGTCCAGACAGCAAGAGGGCGG - Intronic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062291941 9:135799409-135799431 CTTTGCAGGCTGGTGGAGGAAGG - Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062466005 9:136681927-136681949 CTTTGCACACAGGAGGTGCAGGG - Intronic
1062590252 9:137271357-137271379 GTGTGCGGACAGGTTGAGGATGG - Intronic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185831688 X:3309525-3309547 CAATGCAGACACGAGAAGGAGGG - Exonic
1185865483 X:3620243-3620265 CTATGCAGTCAGGAAAAGGAAGG + Intronic
1186496800 X:10017136-10017158 CTGTGCAGGTAGGAGGAAGCAGG - Intronic
1187053940 X:15723075-15723097 CTGGGATGACAAGAGGAGGAGGG - Intronic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187492130 X:19761950-19761972 CTGTGCAGCTATGAGGAAGAGGG - Intronic
1188438474 X:30189864-30189886 CTGTGCAGGCAGCAGCAGAAGGG - Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1190137029 X:47806921-47806943 TTTTCCAGAAAGGAGGAGGATGG - Intergenic
1190141423 X:47848884-47848906 CTGAGCAGACAGGAGAAAGATGG - Intronic
1192146423 X:68686001-68686023 GGGGGCAGACAGGAGGTGGAGGG + Intronic
1195007873 X:100704482-100704504 CTGAGCAGAGAGGATGAAGAAGG + Intronic
1195056286 X:101148618-101148640 ATATGCAGGCAGGTGGAGGAGGG + Intronic
1195112437 X:101660956-101660978 CTGCCCTGTCAGGAGGAGGAGGG + Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1198402652 X:136282360-136282382 CTGGCCAGACAGGAGCAGGCAGG + Intergenic
1198534190 X:137570318-137570340 GTGTGCAGAGAGCAAGAGGAAGG - Exonic
1198963632 X:142206038-142206060 CTGTCTGGACAGGAGAAGGAAGG - Intergenic
1199321870 X:146449073-146449095 GTCTGGAGACAGGAGGAAGATGG - Intergenic
1199712269 X:150477734-150477756 GTGGGCAGAGAGGAGGGGGAAGG + Intronic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic