ID: 969286574

View in Genome Browser
Species Human (GRCh38)
Location 4:6206201-6206223
Sequence GCCTTCATGCTGCTGTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969286574_969286578 10 Left 969286574 4:6206201-6206223 CCAGTGAACAGCAGCATGAAGGC 0: 1
1: 0
2: 2
3: 12
4: 172
Right 969286578 4:6206234-6206256 GATTTGACCTTCCACTTGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 124
969286574_969286586 30 Left 969286574 4:6206201-6206223 CCAGTGAACAGCAGCATGAAGGC 0: 1
1: 0
2: 2
3: 12
4: 172
Right 969286586 4:6206254-6206276 AGGGAGCCACTGGGGGCTCTTGG 0: 1
1: 0
2: 2
3: 55
4: 459
969286574_969286581 20 Left 969286574 4:6206201-6206223 CCAGTGAACAGCAGCATGAAGGC 0: 1
1: 0
2: 2
3: 12
4: 172
Right 969286581 4:6206244-6206266 TCCACTTGAAAGGGAGCCACTGG 0: 1
1: 0
2: 1
3: 8
4: 161
969286574_969286585 23 Left 969286574 4:6206201-6206223 CCAGTGAACAGCAGCATGAAGGC 0: 1
1: 0
2: 2
3: 12
4: 172
Right 969286585 4:6206247-6206269 ACTTGAAAGGGAGCCACTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 183
969286574_969286579 11 Left 969286574 4:6206201-6206223 CCAGTGAACAGCAGCATGAAGGC 0: 1
1: 0
2: 2
3: 12
4: 172
Right 969286579 4:6206235-6206257 ATTTGACCTTCCACTTGAAAGGG 0: 1
1: 0
2: 1
3: 11
4: 189
969286574_969286583 21 Left 969286574 4:6206201-6206223 CCAGTGAACAGCAGCATGAAGGC 0: 1
1: 0
2: 2
3: 12
4: 172
Right 969286583 4:6206245-6206267 CCACTTGAAAGGGAGCCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 143
969286574_969286584 22 Left 969286574 4:6206201-6206223 CCAGTGAACAGCAGCATGAAGGC 0: 1
1: 0
2: 2
3: 12
4: 172
Right 969286584 4:6206246-6206268 CACTTGAAAGGGAGCCACTGGGG 0: 1
1: 0
2: 1
3: 10
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969286574 Original CRISPR GCCTTCATGCTGCTGTTCAC TGG (reversed) Intergenic
900165215 1:1241774-1241796 ACCATCATGCTGCTGCTCCCTGG - Intergenic
900798663 1:4724592-4724614 GCCTGCATGGTGCTTTCCACCGG + Intronic
901207171 1:7503896-7503918 GCCTCCATGCTTCTGTCCCCTGG - Intronic
901429060 1:9201405-9201427 GCCTTCATGGTCTTGTTCACTGG - Intergenic
902366867 1:15981388-15981410 ACCCCCATGCTGCTGTTCTCAGG - Intergenic
906102659 1:43273083-43273105 GGCCTCGTGCTGCTGGTCACCGG + Exonic
907301226 1:53487494-53487516 GCCATCATGCTTCTGGTCACTGG + Intergenic
910289104 1:85582604-85582626 ACTTTCAGGCTGCTGTACACTGG - Exonic
912174974 1:107143110-107143132 GCCTTCATGGTGGTCTTCAGTGG - Intronic
915162248 1:153928997-153929019 GCCTTCCTGGTGCTGTTGCCAGG + Intergenic
915612642 1:157006865-157006887 GAGCTCATGCTGCTGTTCTCAGG - Intronic
917586681 1:176434189-176434211 GCCTTTCTGCTGATATTCACAGG + Intergenic
919956955 1:202427096-202427118 CCCTCCATGCTGCTGCACACTGG + Exonic
920243940 1:204573968-204573990 GCCTTCCAGCTGCTTTTCTCTGG - Intergenic
921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG + Intergenic
922274424 1:224063820-224063842 GCATTCATGCTGCTCCTCTCAGG + Intergenic
1062906197 10:1180968-1180990 GGCTTCATGATGCTGGCCACTGG + Exonic
1063227992 10:4034140-4034162 GCCTTCAAACTGCTGTCCAGGGG - Intergenic
1064852540 10:19725273-19725295 ACCCTCATGCTGCTATTCTCAGG + Intronic
1066440473 10:35434124-35434146 GCCTTCATGCTACATGTCACTGG - Intronic
1066471159 10:35699614-35699636 GCCTTCCTGCTTCTGGTGACTGG - Intergenic
1067168005 10:43880456-43880478 TGCTTCATGCTGCTGCTCCCCGG + Intergenic
1067800572 10:49355746-49355768 GCTTTCACTCTGATGTTCACTGG + Intergenic
1068426182 10:56867416-56867438 TCCTTCATGATGCTGTTCCTGGG - Intergenic
1069868791 10:71520676-71520698 GCCTTCTTGATGCAGGTCACAGG + Intronic
1070792396 10:79197091-79197113 GCCTTCATCCTGCTGTCGGCAGG - Intronic
1071883462 10:89924499-89924521 CCCTTCTTGCTGCTGTTTCCAGG - Intergenic
1073170799 10:101506260-101506282 GGCTTCATGCTTCAGTTCAAAGG - Intronic
1074094226 10:110294892-110294914 GCCTTCATGCTGGGCATCACTGG - Intronic
1074892099 10:117744226-117744248 GCCTTCATTCTGCCTTTCCCTGG - Intergenic
1076547058 10:131252496-131252518 GCCTGCATGCTCCTGAACACAGG + Intronic
1077266705 11:1654516-1654538 GACTCCATGCTGGTGTCCACAGG - Intergenic
1077341107 11:2026747-2026769 CCCTTTATGCTGCTGCCCACGGG - Intergenic
1077518787 11:3018825-3018847 GCCTTGTTGGTGCTGTCCACAGG + Intronic
1077644771 11:3913493-3913515 TGCTTCTTGCTGCTGTTCATGGG + Intronic
1080126562 11:28741433-28741455 CACTTCCTGCTGCTCTTCACAGG + Intergenic
1081049785 11:38324270-38324292 GCCCTGCTGATGCTGTTCACAGG + Intergenic
1081625442 11:44652557-44652579 GAATTCATGCTGCTGTTTCCTGG - Intergenic
1083544812 11:63540475-63540497 TCCTTCATTCTGCTTTTAACTGG - Intronic
1084769173 11:71331645-71331667 GCATTCCTGCTGGTGTTCCCTGG + Intergenic
1086982731 11:93216536-93216558 ACATTTCTGCTGCTGTTCACAGG + Intergenic
1087218072 11:95516373-95516395 AGCTGCATGCTGCTGTCCACCGG + Intergenic
1089844899 11:121451080-121451102 GCATACAAGCTGCTGTTCAGGGG - Intergenic
1202824092 11_KI270721v1_random:81936-81958 CCCTTTATGCTGCTGCCCACGGG - Intergenic
1094221621 12:28000050-28000072 GCCTGCATGCAGCTGGTCAGAGG - Intergenic
1095948335 12:47766606-47766628 TCCTTCATGCTGCTCTCCCCAGG + Intronic
1097621950 12:61949411-61949433 GCCTTCCTTCTGCAGTTGACAGG - Intronic
1098534934 12:71583659-71583681 GCCATCAAGCAGGTGTTCACAGG - Exonic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1103429886 12:120874563-120874585 GCCTTTGTGCTGCTGTTATCAGG - Intronic
1104769875 12:131354759-131354781 GCCTCCTTTCTGCTCTTCACAGG - Intergenic
1105835727 13:24209834-24209856 GCCTCCATGCTGTTTTCCACAGG + Intronic
1106122540 13:26872631-26872653 GTCTTCCTGCTCCTTTTCACCGG - Intergenic
1113056963 13:106278515-106278537 ACCTTCATGCTGCTGCTCATCGG - Intergenic
1115811226 14:37110313-37110335 GCCTTCATCCTGCTATTTAGTGG - Intronic
1117350512 14:54877211-54877233 ACCTTCTTGCTGCTGATAACAGG - Intronic
1119390284 14:74287005-74287027 GATTTCATGCAGCTGCTCACAGG - Intronic
1119415315 14:74465771-74465793 GCCCTCATGCTGATGTTCACAGG - Intergenic
1119832767 14:77718109-77718131 GCCTTCATGCTCGTGTTCCTTGG + Exonic
1122658314 14:103278018-103278040 ACCTCCATGCTGCTGTTCTCAGG + Intergenic
1124663433 15:31569956-31569978 GCCTGCAAGCTGCGGTGCACTGG + Intronic
1126420562 15:48467986-48468008 AGCTTCCTGCTGCTGTTCTCTGG - Exonic
1128559403 15:68654865-68654887 GCCTTCCTGCTACTGTTGTCTGG + Intronic
1129115637 15:73363972-73363994 GACTTCCTGCTGCTGGTCACTGG - Intronic
1129306067 15:74663891-74663913 GCCTTAATGATGCTGGGCACTGG + Intronic
1130600971 15:85272931-85272953 GCCTTCATGCTTATGTTCTTTGG - Intergenic
1131282213 15:91031264-91031286 GCCTTCATGCTCATGTTCTCTGG + Intergenic
1132024439 15:98392856-98392878 CCCTTGATGCTGCTGGTCCCTGG - Intergenic
1132645796 16:998752-998774 GCCCTCACGCTGCTGCTCGCTGG - Intergenic
1132814243 16:1818307-1818329 GCCTTCAGGCTGCAGTGCGCAGG - Intronic
1133415586 16:5604640-5604662 GCCTACATGCTACTGATCATGGG + Intergenic
1135994370 16:27237291-27237313 GCCTCCATGCCCCTGCTCACGGG + Intronic
1137384601 16:48030006-48030028 CCCTTCCAGCTGCTGGTCACAGG - Intergenic
1138169052 16:54831352-54831374 GCCAACATGCTGCTTTTCTCTGG + Intergenic
1140123259 16:72101036-72101058 GCCTTCTTGCTGATTTTAACGGG + Intronic
1142002111 16:87670020-87670042 GCCTTCATCCTTCCATTCACAGG + Intronic
1144968171 17:19090696-19090718 GCCTTCAGGTTGCTGTGCAATGG - Intergenic
1144979746 17:19161367-19161389 GCCTTCAGGTTGCTGTGCAATGG + Intergenic
1144988476 17:19216865-19216887 GCCTTCAGGTTGCTGTGCAATGG - Intronic
1145274967 17:21423730-21423752 CCCTTCCTGCTCCTGGTCACTGG - Intergenic
1145312821 17:21709630-21709652 CCCTTCCTGCTCCTGGTCACTGG - Intergenic
1150846454 17:68663681-68663703 GGATTGAAGCTGCTGTTCACAGG - Intergenic
1151802476 17:76386116-76386138 TCCTTCACGCTGATGCTCACTGG + Exonic
1152234711 17:79132688-79132710 GGCTTCCAGCTGCTGCTCACTGG + Intronic
1152457619 17:80425311-80425333 GCCTTCCTGCTGCTTGTCCCTGG - Intronic
1153393396 18:4590125-4590147 GCCTTGATTCTGCTTGTCACTGG + Intergenic
1153760326 18:8324827-8324849 GCCTTGATGCTGGAGTTCAGTGG - Intronic
1154315105 18:13298101-13298123 GCCTCCCTGCTGCTGTTGAGGGG + Intronic
1156204431 18:34870768-34870790 GCCTTGCTCCTGCTGTTCCCAGG + Intronic
1156377445 18:36527656-36527678 GCCTACATGCTGCAGCTCAAAGG - Intronic
1157088371 18:44605573-44605595 GCCTTCATGTTGTTATTCTCAGG + Intergenic
1157711547 18:49853199-49853221 GCCTTCTTGCTGAATTTCACTGG - Intronic
1160514992 18:79473231-79473253 GCCCACAGGCCGCTGTTCACAGG - Intronic
1160612063 18:80096339-80096361 GCCTTAATGCTGCAGCCCACAGG + Exonic
1161233996 19:3189062-3189084 TCCTTCCTGCTGCTGTTGAGAGG + Intronic
1165119397 19:33549390-33549412 ACCTCCAGGCTGCGGTTCACCGG + Intergenic
1168693906 19:58394497-58394519 GCCATCTGGCTGCTGTGCACAGG + Exonic
926336799 2:11869568-11869590 GCCTTCAGGATCCTGTTTACTGG + Intergenic
927162063 2:20274073-20274095 GCCTTAATTCTGTTATTCACTGG + Intronic
928002506 2:27537243-27537265 CCCTTCCTGCAGCTGTCCACAGG - Intergenic
930031548 2:47061073-47061095 GCCTTGCTACTGCTGTTCCCTGG + Intronic
930559959 2:52949215-52949237 ACCCCCATGCTGCTGTTCTCAGG - Intergenic
932977218 2:76617749-76617771 CCCATCATGCTGCTGTTGATTGG - Intergenic
933065580 2:77790915-77790937 ACCTTCATGGAGCTGTTCAGTGG - Intergenic
935528065 2:104197207-104197229 GCTTGCCTGCTGCTGGTCACAGG + Intergenic
935701487 2:105815982-105816004 TCCTTCCACCTGCTGTTCACCGG + Intronic
935797594 2:106659993-106660015 TTATTCATGCTGCTGTTCACAGG + Intergenic
937887819 2:126912079-126912101 GCCTTCATGCTGCTTTTTCCTGG + Intergenic
942208580 2:173648159-173648181 GCCTCCAGGCTGCTGTGTACAGG - Intergenic
942962705 2:181851975-181851997 TTCTTCATTCTGCTTTTCACAGG - Intergenic
943474152 2:188333776-188333798 GGTTTCAAACTGCTGTTCACAGG - Intronic
944843626 2:203646783-203646805 TTCTTCGTGCTGGTGTTCACTGG + Intergenic
945137596 2:206644871-206644893 TCTTCCTTGCTGCTGTTCACAGG - Intergenic
947517908 2:230823272-230823294 GTCTTCATGCTGCAGTTCACGGG - Intergenic
1170137180 20:13087459-13087481 GTCTTCAAGCTGGTATTCACTGG + Intronic
1172230612 20:33333354-33333376 GCCTCCATCCTGCTGCTCCCAGG - Intergenic
1173032698 20:39377012-39377034 GCCTTGATGCTGGTTTTCTCAGG + Intergenic
1176213126 20:63935232-63935254 TCATTCATGCTGCTGTCCCCTGG + Exonic
1177241234 21:18460637-18460659 GAGTTCATGCTGCAGTTCAAAGG + Intronic
1178494460 21:33075331-33075353 TCCCTCCTGCTGCTGTTGACAGG + Intergenic
1178942426 21:36917296-36917318 GCCTTCATGCTGCCTTTGCCGGG + Intronic
1179902253 21:44400334-44400356 GCCTTCCCGCTGCTCCTCACCGG + Exonic
1180165086 21:46021475-46021497 GCCTTCATGTTGCTTTTCTGTGG + Intergenic
1180832573 22:18913490-18913512 GCCTGCATCCTGCTGACCACCGG - Exonic
1181651529 22:24261706-24261728 CTCCTCCTGCTGCTGTTCACCGG - Intergenic
1182329333 22:29539493-29539515 GACATCAAGCTGCTGTTCTCAGG + Intronic
950838469 3:15943198-15943220 GGCTTCAAGAGGCTGTTCACAGG - Intergenic
953882728 3:46700048-46700070 TTCCTCATGCTGCTGGTCACAGG - Intergenic
956423062 3:69104572-69104594 GCCTTCTTCCTGCTGTTCTAGGG - Exonic
963690940 3:148502077-148502099 TCTTTCTTGCTGCAGTTCACTGG + Intergenic
964314766 3:155431926-155431948 GAGTTAATGCTGCAGTTCACAGG + Intronic
966547323 3:181165021-181165043 GCTTTCATGTTGCTGTTTAGTGG + Intergenic
968263451 3:197343658-197343680 GCCTTCATGGTGTTGTTTGCTGG - Intergenic
969286574 4:6206201-6206223 GCCTTCATGCTGCTGTTCACTGG - Intergenic
970053540 4:11945155-11945177 GCCTTGCTGCTGCTGGTCACTGG + Intergenic
970238743 4:13985714-13985736 GCCTTCATCCTGCTGGCCTCGGG + Intergenic
973086504 4:46068775-46068797 TACTTCATGTTCCTGTTCACAGG + Intronic
976407544 4:84677303-84677325 GCCGTTCTGCTGCTGATCACTGG - Exonic
977299346 4:95250183-95250205 GCTTGCTTGCTGCTTTTCACAGG - Intronic
982252339 4:153419915-153419937 ACCCCCATGCTGCTGTTCTCGGG - Intergenic
988093411 5:26569974-26569996 GCCTTCAGGCAGGTGTTCGCGGG + Intergenic
991686807 5:69189316-69189338 CCCTCCAGGCTGCTGTTCCCGGG + Intergenic
992671010 5:79061287-79061309 TTCTTCATGCTGCTGCTCAGAGG + Intronic
996882238 5:128312682-128312704 CTCTTCATGCTGCTGCTCTCTGG - Exonic
998061317 5:139120935-139120957 TCCTTCAGGCTGCTCTTCTCTGG - Intronic
999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG + Intronic
1003117348 6:3292162-3292184 AGCTTCATGCTGTTGTTGACAGG - Intronic
1003242516 6:4357317-4357339 GCCAGCATGCTGATGTTTACAGG - Intergenic
1003445768 6:6182756-6182778 GCCTTAATGATGCTGTTAAATGG + Intronic
1003875873 6:10436110-10436132 GCCTTGATGATGCTGTTCTTAGG + Intergenic
1006154790 6:32008256-32008278 GCCTTCACGCTGCTGCCCTCCGG + Intergenic
1006161102 6:32040991-32041013 GCCTTCACGCTGCTGCCCTCCGG + Exonic
1008829669 6:55742431-55742453 GCATTCATACTGTTGTGCACTGG - Intergenic
1010267173 6:73880074-73880096 GCCTTCTTGCTGTTGGCCACTGG + Intergenic
1011805952 6:91072572-91072594 TCTGTCATGCTGCTGTTCTCAGG + Intergenic
1012189627 6:96263257-96263279 GCCTCCAGACTGCTCTTCACGGG - Intergenic
1013991462 6:116258646-116258668 GCCATCTGGCTGCTGTGCACAGG - Intronic
1016633525 6:146259862-146259884 ACTTTCATGCTGTTCTTCACAGG + Intronic
1018403660 6:163453321-163453343 TCTTTCATGCTGCTATTCTCAGG + Intronic
1018436134 6:163760736-163760758 GGTTTGATGCTGCTGTTCATAGG - Intergenic
1019222600 6:170485952-170485974 GCCTTCAAGGTGCTTTTCACAGG + Intergenic
1020261328 7:6532114-6532136 CCCCTCCTGCTGCTGTTCAGGGG - Intronic
1025936175 7:66039483-66039505 GGCTTCAAGCTGCAGTTCCCAGG + Intergenic
1029624113 7:101709118-101709140 GCCTTCCTGATGCTGTGCCCTGG + Intergenic
1030722247 7:112884123-112884145 ACCCCCATGCTGCTGTTCTCAGG - Intronic
1032151635 7:129434458-129434480 TCCTCCATGCTGCTGGTCAGCGG - Exonic
1034095105 7:148400394-148400416 GAATTCATGCTGATGTTAACAGG - Intronic
1034116998 7:148592209-148592231 CAGTTCATGCTGCTGTTCTCAGG - Intronic
1037688303 8:21162393-21162415 ACCTTCCTGCAGCTGTACACTGG - Intergenic
1042504601 8:69546469-69546491 GCTTTCCAGCTGCTGTCCACAGG + Intronic
1043292485 8:78620304-78620326 GCCTTCATGCAAATGTTTACTGG - Intergenic
1045826905 8:106408815-106408837 AGCTTCTTGCTGCTGTTCTCTGG - Intronic
1047338475 8:123957852-123957874 GCATCCATCCTGCTGTCCACAGG + Intronic
1050203785 9:3176807-3176829 GCCTTCAGGATCCTGTCCACAGG + Intergenic
1050583143 9:7082029-7082051 GCCACCATGATGCTTTTCACAGG - Intergenic
1052275006 9:26665462-26665484 GCCTTCATGGAGCTGTAGACTGG - Intergenic
1055215767 9:73860218-73860240 GCCTTTCTACTTCTGTTCACTGG - Intergenic
1058930396 9:109713278-109713300 GCCTTCATGCTGCAGATCAAAGG + Intronic
1059575875 9:115487895-115487917 TCCTTTATGCTACTGTGCACGGG - Intergenic
1061282797 9:129607175-129607197 CCCTTCTTGGTGCTGTTCATAGG + Intergenic
1186126701 X:6422237-6422259 GCCATCTGGCTGCTGTGCACAGG - Intergenic
1186160212 X:6769479-6769501 GCCTTGATGCTGCTGATGTCTGG - Intergenic
1195906986 X:109853755-109853777 GCCATCTGGCTGCTGTACACAGG + Intergenic
1196677170 X:118431810-118431832 GCTTTGGTTCTGCTGTTCACAGG + Intronic
1197758977 X:130014717-130014739 GCCTTGCTGCTGGTGTGCACGGG - Exonic
1199257572 X:145734078-145734100 TCCTTCCTGTTGCTCTTCACTGG - Intergenic
1202576912 Y:26337443-26337465 CCCTCCATGCTGCTGCACACTGG - Intergenic