ID: 969288888

View in Genome Browser
Species Human (GRCh38)
Location 4:6226128-6226150
Sequence CAAGTGGCTCACAGTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969288888_969288896 23 Left 969288888 4:6226128-6226150 CCCATGGCACTGTGAGCCACTTG No data
Right 969288896 4:6226174-6226196 AGCCCTCTAGCTTCTGAGCCTGG No data
969288888_969288899 29 Left 969288888 4:6226128-6226150 CCCATGGCACTGTGAGCCACTTG No data
Right 969288899 4:6226180-6226202 CTAGCTTCTGAGCCTGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969288888 Original CRISPR CAAGTGGCTCACAGTGCCAT GGG (reversed) Intergenic
No off target data available for this crispr