ID: 969288896

View in Genome Browser
Species Human (GRCh38)
Location 4:6226174-6226196
Sequence AGCCCTCTAGCTTCTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969288888_969288896 23 Left 969288888 4:6226128-6226150 CCCATGGCACTGTGAGCCACTTG No data
Right 969288896 4:6226174-6226196 AGCCCTCTAGCTTCTGAGCCTGG No data
969288886_969288896 27 Left 969288886 4:6226124-6226146 CCTCCCCATGGCACTGTGAGCCA No data
Right 969288896 4:6226174-6226196 AGCCCTCTAGCTTCTGAGCCTGG No data
969288893_969288896 -9 Left 969288893 4:6226160-6226182 CCTGTGCCTTATCCAGCCCTCTA No data
Right 969288896 4:6226174-6226196 AGCCCTCTAGCTTCTGAGCCTGG No data
969288892_969288896 7 Left 969288892 4:6226144-6226166 CCACTTGAGGGCAGAGCCTGTGC No data
Right 969288896 4:6226174-6226196 AGCCCTCTAGCTTCTGAGCCTGG No data
969288889_969288896 22 Left 969288889 4:6226129-6226151 CCATGGCACTGTGAGCCACTTGA No data
Right 969288896 4:6226174-6226196 AGCCCTCTAGCTTCTGAGCCTGG No data
969288887_969288896 24 Left 969288887 4:6226127-6226149 CCCCATGGCACTGTGAGCCACTT No data
Right 969288896 4:6226174-6226196 AGCCCTCTAGCTTCTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969288896 Original CRISPR AGCCCTCTAGCTTCTGAGCC TGG Intergenic
No off target data available for this crispr