ID: 969288899

View in Genome Browser
Species Human (GRCh38)
Location 4:6226180-6226202
Sequence CTAGCTTCTGAGCCTGGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969288888_969288899 29 Left 969288888 4:6226128-6226150 CCCATGGCACTGTGAGCCACTTG No data
Right 969288899 4:6226180-6226202 CTAGCTTCTGAGCCTGGCATAGG No data
969288889_969288899 28 Left 969288889 4:6226129-6226151 CCATGGCACTGTGAGCCACTTGA No data
Right 969288899 4:6226180-6226202 CTAGCTTCTGAGCCTGGCATAGG No data
969288893_969288899 -3 Left 969288893 4:6226160-6226182 CCTGTGCCTTATCCAGCCCTCTA No data
Right 969288899 4:6226180-6226202 CTAGCTTCTGAGCCTGGCATAGG No data
969288894_969288899 -9 Left 969288894 4:6226166-6226188 CCTTATCCAGCCCTCTAGCTTCT No data
Right 969288899 4:6226180-6226202 CTAGCTTCTGAGCCTGGCATAGG No data
969288892_969288899 13 Left 969288892 4:6226144-6226166 CCACTTGAGGGCAGAGCCTGTGC No data
Right 969288899 4:6226180-6226202 CTAGCTTCTGAGCCTGGCATAGG No data
969288887_969288899 30 Left 969288887 4:6226127-6226149 CCCCATGGCACTGTGAGCCACTT No data
Right 969288899 4:6226180-6226202 CTAGCTTCTGAGCCTGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969288899 Original CRISPR CTAGCTTCTGAGCCTGGCAT AGG Intergenic
No off target data available for this crispr