ID: 969289925

View in Genome Browser
Species Human (GRCh38)
Location 4:6232120-6232142
Sequence CCAAATAAGGAGAAGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969289925_969289933 26 Left 969289925 4:6232120-6232142 CCTGCGGCCTTCTCCTTATTTGG No data
Right 969289933 4:6232169-6232191 CAAAAACCTGGTGTGTTACAAGG No data
969289925_969289932 14 Left 969289925 4:6232120-6232142 CCTGCGGCCTTCTCCTTATTTGG No data
Right 969289932 4:6232157-6232179 ATTGTCGTCATGCAAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969289925 Original CRISPR CCAAATAAGGAGAAGGCCGC AGG (reversed) Intergenic
No off target data available for this crispr