ID: 969291652 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:6243908-6243930 |
Sequence | GCTGGTCCTGGGGCAGGACA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
969291652_969291667 | 27 | Left | 969291652 | 4:6243908-6243930 | CCATGTCCTGCCCCAGGACCAGC | No data | ||
Right | 969291667 | 4:6243958-6243980 | TGTAGCTCCCATAGCAGCAAAGG | No data | ||||
969291652_969291659 | -4 | Left | 969291652 | 4:6243908-6243930 | CCATGTCCTGCCCCAGGACCAGC | No data | ||
Right | 969291659 | 4:6243927-6243949 | CAGCCTCCAGGACCCCTCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
969291652 | Original CRISPR | GCTGGTCCTGGGGCAGGACA TGG (reversed) | Intergenic | ||