ID: 969291652

View in Genome Browser
Species Human (GRCh38)
Location 4:6243908-6243930
Sequence GCTGGTCCTGGGGCAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291652_969291667 27 Left 969291652 4:6243908-6243930 CCATGTCCTGCCCCAGGACCAGC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291652_969291659 -4 Left 969291652 4:6243908-6243930 CCATGTCCTGCCCCAGGACCAGC No data
Right 969291659 4:6243927-6243949 CAGCCTCCAGGACCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291652 Original CRISPR GCTGGTCCTGGGGCAGGACA TGG (reversed) Intergenic