ID: 969291653

View in Genome Browser
Species Human (GRCh38)
Location 4:6243914-6243936
Sequence CTGGAGGCTGGTCCTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291653_969291659 -10 Left 969291653 4:6243914-6243936 CCTGCCCCAGGACCAGCCTCCAG No data
Right 969291659 4:6243927-6243949 CAGCCTCCAGGACCCCTCCCAGG No data
969291653_969291668 25 Left 969291653 4:6243914-6243936 CCTGCCCCAGGACCAGCCTCCAG No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291653_969291667 21 Left 969291653 4:6243914-6243936 CCTGCCCCAGGACCAGCCTCCAG No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291653 Original CRISPR CTGGAGGCTGGTCCTGGGGC AGG (reversed) Intergenic