ID: 969291655

View in Genome Browser
Species Human (GRCh38)
Location 4:6243918-6243940
Sequence GGTCCTGGAGGCTGGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291655_969291667 17 Left 969291655 4:6243918-6243940 CCCCAGGACCAGCCTCCAGGACC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291655_969291668 21 Left 969291655 4:6243918-6243940 CCCCAGGACCAGCCTCCAGGACC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291655 Original CRISPR GGTCCTGGAGGCTGGTCCTG GGG (reversed) Intergenic