ID: 969291658

View in Genome Browser
Species Human (GRCh38)
Location 4:6243926-6243948
Sequence CTGGGAGGGGTCCTGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291658_969291668 13 Left 969291658 4:6243926-6243948 CCAGCCTCCAGGACCCCTCCCAG No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291658_969291672 29 Left 969291658 4:6243926-6243948 CCAGCCTCCAGGACCCCTCCCAG No data
Right 969291672 4:6243978-6244000 AGGAAGGATGCAAAGTCTCAGGG No data
969291658_969291671 28 Left 969291658 4:6243926-6243948 CCAGCCTCCAGGACCCCTCCCAG No data
Right 969291671 4:6243977-6243999 AAGGAAGGATGCAAAGTCTCAGG No data
969291658_969291667 9 Left 969291658 4:6243926-6243948 CCAGCCTCCAGGACCCCTCCCAG No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291658 Original CRISPR CTGGGAGGGGTCCTGGAGGC TGG (reversed) Intergenic