ID: 969291660

View in Genome Browser
Species Human (GRCh38)
Location 4:6243930-6243952
Sequence GCACCTGGGAGGGGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291660_969291668 9 Left 969291660 4:6243930-6243952 CCTCCAGGACCCCTCCCAGGTGC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291660_969291671 24 Left 969291660 4:6243930-6243952 CCTCCAGGACCCCTCCCAGGTGC No data
Right 969291671 4:6243977-6243999 AAGGAAGGATGCAAAGTCTCAGG No data
969291660_969291667 5 Left 969291660 4:6243930-6243952 CCTCCAGGACCCCTCCCAGGTGC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291660_969291672 25 Left 969291660 4:6243930-6243952 CCTCCAGGACCCCTCCCAGGTGC No data
Right 969291672 4:6243978-6244000 AGGAAGGATGCAAAGTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291660 Original CRISPR GCACCTGGGAGGGGTCCTGG AGG (reversed) Intergenic