ID: 969291663

View in Genome Browser
Species Human (GRCh38)
Location 4:6243940-6243962
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291663_969291667 -5 Left 969291663 4:6243940-6243962 CCCTCCCAGGTGCTCAAGTGTAG No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291663_969291673 24 Left 969291663 4:6243940-6243962 CCCTCCCAGGTGCTCAAGTGTAG No data
Right 969291673 4:6243987-6244009 GCAAAGTCTCAGGGCTTTGCAGG No data
969291663_969291672 15 Left 969291663 4:6243940-6243962 CCCTCCCAGGTGCTCAAGTGTAG No data
Right 969291672 4:6243978-6244000 AGGAAGGATGCAAAGTCTCAGGG No data
969291663_969291668 -1 Left 969291663 4:6243940-6243962 CCCTCCCAGGTGCTCAAGTGTAG No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291663_969291671 14 Left 969291663 4:6243940-6243962 CCCTCCCAGGTGCTCAAGTGTAG No data
Right 969291671 4:6243977-6243999 AAGGAAGGATGCAAAGTCTCAGG No data
969291663_969291674 27 Left 969291663 4:6243940-6243962 CCCTCCCAGGTGCTCAAGTGTAG No data
Right 969291674 4:6243990-6244012 AAGTCTCAGGGCTTTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291663 Original CRISPR CTACACTTGAGCACCTGGGA GGG (reversed) Intergenic